DNA והמסתעף - נפלאות הבורא

געשמאקע ארטיקלן און בילדער וכדו'

די אחראים: אחראי, געלעגער

Waukesha
שר חמישים ומאתים
תגובות: 339
זיך איינגעשריבען אום: מאנטאג דעצמבער 03, 2018 12:31 pm
לאקאציע: Waukesha City, Waukesha County WI

תגובהדורך Waukesha » דאנארשטאג אוקטובער 03, 2019 5:52 pm

איצל פיצל האט געשריבן:קודם א ריזיגן יישר כח פאר דיין געוואלדיגע ארבייט.
פארשטיי איך שוין ווייטער נישט.
האסט אויבן געענפערט אז א יעדע DNA האט א ריקן ביין פון צוקער און א זייטיגע קייט וואס הענגט ארויס דערפון, און די זייטיגע קייט באשטייט פון איינס פון פיר מינים. אדער איז עס א A אדער א C אדער א T אדער א G. (איך וועל אנריפן די זייטיגע קייט ״טרעפ״.) און עס איז נישט דא אין איין לייטער פארשידענע מיני טרעפ.


לאמיר זיך אביסל בעסער מסביר זיין. יעדער DNA באשטייט פון א מאליקיועל וואס קוקט אויס אזוי TTTTT (גרעסער אביסל אבער כדי צו פארשטיין) יעדער T קען האבן בלויז איין סארט זייטיגע קייט אבער נישט יעדער T פון די TTTTTT וועט זיין די זעלבע, קומט אויס אז די TTTTT קען יא זיין קאלירפול

איצל פיצל האט געשריבן:
אויך שרייבסטו אז יעדע DNA קאנעקט זיך צו זיין חבר דורך די ריקן ביין. און באריכות בוסטו שפעטער מסביר אז עס קאנעקט זיך איין האלבע טרעפ מיט די צווייטע האלבע טרעפ, און די צוויי ריקן ביינער זענען ווי די צוויי זייטן פונעם לייטער.

ביטע זיי עס בעסער מסביר. יישר כח נאכאמאל. מורא׳דיג שיין און באלערנד.


די רוקן ביינער זענען באהאפטען מיט קאוועלנט באנדס. דאס מיינט אז אלע רוקן ביינער זענען איין מאליקיועל. משא"כ די האלבע טרעפ זענען באהאפטען בלויז מיט היידרידזשין באנדס. דאס מיינט אז זיי זענען נאך אלץ צוויי באזונדערע מאליקיועלס נאר זיי בלייבן איינער לעבן צווייטען דורך א כעין מאגנעטישער כח

נאו נעים
שר מאה
תגובות: 132
זיך איינגעשריבען אום: מיטוואך אוגוסט 14, 2019 9:20 am

תגובהדורך נאו נעים » דאנארשטאג אוקטובער 03, 2019 6:33 pm

Waukesha האט געשריבן:
איצל פיצל האט געשריבן:קודם א ריזיגן יישר כח פאר דיין געוואלדיגע ארבייט.
פארשטיי איך שוין ווייטער נישט.
האסט אויבן געענפערט אז א יעדע DNA האט א ריקן ביין פון צוקער און א זייטיגע קייט וואס הענגט ארויס דערפון, און די זייטיגע קייט באשטייט פון איינס פון פיר מינים. אדער איז עס א A אדער א C אדער א T אדער א G. (איך וועל אנריפן די זייטיגע קייט ״טרעפ״.) און עס איז נישט דא אין איין לייטער פארשידענע מיני טרעפ.


לאמיר זיך אביסל בעסער מסביר זיין. יעדער DNA באשטייט פון א מאליקיועל וואס קוקט אויס אזוי TTTTT (גרעסער אביסל אבער כדי צו פארשטיין) יעדער T קען האבן בלויז איין סארט זייטיגע קייט אבער נישט יעדער T פון די TTTTTT וועט זיין די זעלבע, קומט אויס אז די TTTTT קען יא זיין קאלירפול

איצל פיצל האט געשריבן:
אויך שרייבסטו אז יעדע DNA קאנעקט זיך צו זיין חבר דורך די ריקן ביין. און באריכות בוסטו שפעטער מסביר אז עס קאנעקט זיך איין האלבע טרעפ מיט די צווייטע האלבע טרעפ, און די צוויי ריקן ביינער זענען ווי די צוויי זייטן פונעם לייטער.

ביטע זיי עס בעסער מסביר. יישר כח נאכאמאל. מורא׳דיג שיין און באלערנד.


די רוקן ביינער זענען באהאפטען מיט קאוועלנט באנדס. דאס מיינט אז אלע רוקן ביינער זענען איין מאליקיועל. משא"כ די האלבע טרעפ זענען באהאפטען בלויז מיט היידרידזשין באנדס. דאס מיינט אז זיי זענען נאך אלץ צוויי באזונדערע מאליקיועלס נאר זיי בלייבן איינער לעבן צווייטען דורך א כעין מאגנעטישער כח

Waukesha (קען איך נישט פראנאונסן אין יודיש).
הערליך שיין און קלאר!

אוועטאר
איצל פיצל
שר חמש מאות
תגובות: 583
זיך איינגעשריבען אום: פרייטאג יולי 11, 2008 1:57 am

תגובהדורך איצל פיצל » דאנארשטאג אוקטובער 03, 2019 7:17 pm

Waukesha האט געשריבן:
איצל פיצל האט געשריבן:קודם א ריזיגן יישר כח פאר דיין געוואלדיגע ארבייט.
פארשטיי איך שוין ווייטער נישט.
האסט אויבן געענפערט אז א יעדע DNA האט א ריקן ביין פון צוקער און א זייטיגע קייט וואס הענגט ארויס דערפון, און די זייטיגע קייט באשטייט פון איינס פון פיר מינים. אדער איז עס א A אדער א C אדער א T אדער א G. (איך וועל אנריפן די זייטיגע קייט ״טרעפ״.) און עס איז נישט דא אין איין לייטער פארשידענע מיני טרעפ.


לאמיר זיך אביסל בעסער מסביר זיין. יעדער DNA באשטייט פון א מאליקיועל וואס קוקט אויס אזוי TTTTT (גרעסער אביסל אבער כדי צו פארשטיין) יעדער T קען האבן בלויז איין סארט זייטיגע קייט אבער נישט יעדער T פון די TTTTTT וועט זיין די זעלבע, קומט אויס אז די TTTTT קען יא זיין קאלירפול

איצל פיצל האט געשריבן:
אויך שרייבסטו אז יעדע DNA קאנעקט זיך צו זיין חבר דורך די ריקן ביין. און באריכות בוסטו שפעטער מסביר אז עס קאנעקט זיך איין האלבע טרעפ מיט די צווייטע האלבע טרעפ, און די צוויי ריקן ביינער זענען ווי די צוויי זייטן פונעם לייטער.

ביטע זיי עס בעסער מסביר. יישר כח נאכאמאל. מורא׳דיג שיין און באלערנד.


די רוקן ביינער זענען באהאפטען מיט קאוועלנט באנדס. דאס מיינט אז אלע רוקן ביינער זענען איין מאליקיועל. משא"כ די האלבע טרעפ זענען באהאפטען בלויז מיט היידרידזשין באנדס. דאס מיינט אז זיי זענען נאך אלץ צוויי באזונדערע מאליקיועלס נאר זיי בלייבן איינער לעבן צווייטען דורך א כעין מאגנעטישער כח

קאפטשאו! איין טעות איז געווען באהאפטן אין מיין אנדערע טעות... סא ווען דו רעדסט אז די ריקן ביינער קאנעקטן זיך מיט א קאוועלנט באנד, מיינט עס אז איין T קאנעקט זיך מיט די נעקסטע T אין עס הייבט זיך אן פארמען איין זייטיגע שטעקן פונעם לייטער מיט פארשידענע מיני טרעפ דערויף.

נאך עפעס, א DNA לייטער קען האבן 4 מיני טרעפ דערויף. דער אמינא עסידס קענען אויך האבן צוואנציג פארשידענע מיני טרעפ אין זיין לייטער?

Waukesha
שר חמישים ומאתים
תגובות: 339
זיך איינגעשריבען אום: מאנטאג דעצמבער 03, 2018 12:31 pm
לאקאציע: Waukesha City, Waukesha County WI

תגובהדורך Waukesha » זונטאג אוקטובער 06, 2019 12:10 am

איצל פיצל האט געשריבן:
Waukesha האט געשריבן:
איצל פיצל האט געשריבן:קודם א ריזיגן יישר כח פאר דיין געוואלדיגע ארבייט.
פארשטיי איך שוין ווייטער נישט.
האסט אויבן געענפערט אז א יעדע DNA האט א ריקן ביין פון צוקער און א זייטיגע קייט וואס הענגט ארויס דערפון, און די זייטיגע קייט באשטייט פון איינס פון פיר מינים. אדער איז עס א A אדער א C אדער א T אדער א G. (איך וועל אנריפן די זייטיגע קייט ״טרעפ״.) און עס איז נישט דא אין איין לייטער פארשידענע מיני טרעפ.


לאמיר זיך אביסל בעסער מסביר זיין. יעדער DNA באשטייט פון א מאליקיועל וואס קוקט אויס אזוי TTTTT (גרעסער אביסל אבער כדי צו פארשטיין) יעדער T קען האבן בלויז איין סארט זייטיגע קייט אבער נישט יעדער T פון די TTTTTT וועט זיין די זעלבע, קומט אויס אז די TTTTT קען יא זיין קאלירפול

איצל פיצל האט געשריבן:
אויך שרייבסטו אז יעדע DNA קאנעקט זיך צו זיין חבר דורך די ריקן ביין. און באריכות בוסטו שפעטער מסביר אז עס קאנעקט זיך איין האלבע טרעפ מיט די צווייטע האלבע טרעפ, און די צוויי ריקן ביינער זענען ווי די צוויי זייטן פונעם לייטער.

ביטע זיי עס בעסער מסביר. יישר כח נאכאמאל. מורא׳דיג שיין און באלערנד.


די רוקן ביינער זענען באהאפטען מיט קאוועלנט באנדס. דאס מיינט אז אלע רוקן ביינער זענען איין מאליקיועל. משא"כ די האלבע טרעפ זענען באהאפטען בלויז מיט היידרידזשין באנדס. דאס מיינט אז זיי זענען נאך אלץ צוויי באזונדערע מאליקיועלס נאר זיי בלייבן איינער לעבן צווייטען דורך א כעין מאגנעטישער כח

קאפטשאו! איין טעות איז געווען באהאפטן אין מיין אנדערע טעות... סא ווען דו רעדסט אז די ריקן ביינער קאנעקטן זיך מיט א קאוועלנט באנד, מיינט עס אז איין T קאנעקט זיך מיט די נעקסטע T אין עס הייבט זיך אן פארמען איין זייטיגע שטעקן פונעם לייטער מיט פארשידענע מיני טרעפ דערויף.

נאך עפעס, א DNA לייטער קען האבן 4 מיני טרעפ דערויף. דער אמינא עסידס קענען אויך האבן צוואנציג פארשידענע מיני טרעפ אין זיין לייטער?


ריכטיג דער אמינא אסידס קענען האבן 20 פארשידענע מינע טרעפ אין זיין לייטער. (די אמינא אסידס צוזאמען אבער שאפען נישט קיין לייטער, נאר יעדער פראטעין וועט זיך שאפן זיין אייגענער shape)

אוועטאר
שרייזשע
שר חמש מאות
תגובות: 733
זיך איינגעשריבען אום: זונטאג מארטש 18, 2018 4:43 pm
לאקאציע: ליידער און גלות

תגובהדורך שרייזשע » זונטאג אוקטובער 06, 2019 12:12 am

א גרויסען דאנקע Waukesha. עס איז גאר אינטערסאנט.
קיפ אן!
צעקה בקול דממה דקה

Waukesha
שר חמישים ומאתים
תגובות: 339
זיך איינגעשריבען אום: מאנטאג דעצמבער 03, 2018 12:31 pm
לאקאציע: Waukesha City, Waukesha County WI

תגובהדורך Waukesha » מאנטאג אוקטובער 07, 2019 8:24 pm


  • DNA איז רת Deoxyribonucleaic acid
  • DNA איז צוזאם געשטעלט פון א צוקער רוקנביין און 4 סארט זייטיגע קייטען
  • די צוקער פון DNA רוקנביין איז א פיניווער צוקער
  • אטאמען האבן בדרך כלל די זעלבע צאל פראטאנס ווי עלעקטראנס.
  • א חלק פון אירע עלעקטראנס וועט אן אטאם זיך טיילן מיט א צווייטן אטאם וואס איז זיך אויך גרייט צו טיילן
  • ווען אטאמען טיילן זיך עלעקטראנס הייסט עס א קאוועלענט באנד
  • ווען אטאמען טיילן זיך עלעקטראנס, וועט יעדער אטאם פרובירן צו כאפן ביידע עלעקטראנס
  • אויב איין אטאם איז שטערקער וועט עס באקומען מער פון די עלעקטראנס
  • דער אומבאלאנס איז גורם אז די מאליקיועלס וועלען זיך אויפפירן כעין מאגנעטן
  • גרעסערע מאליקיועלס קענען האבן מערערע פאלער באנדס
  • ווען מאליקיועלס האלטן זיך צוזאמען דורך דער כעין מעגניטשע כח, הייסט עס א היידרידזשין באנד
  • מאליקיועלס וואס האבן מער פון איין פאלער באנד וועלען אויפזוכן מאליקיועלס מיט וועם זיי קענען מאכן די מערסטע היידרידזשין באנדס
  • די 4 זייטיגע קייטן פון DNA האבן צוויי פארן וואס מאכן היידירדזשין באנדס איינעם מיטן צווייטן, A און T, מיט C און G.
  • DNA קומט געווענליך אין פארן פון 2, ווי יעדער איינס פון די פאר האט די פערקערטע זייטיגע קייטן פונעם צווייטן.
  • די צוויי DNA מאליקיועלס שטעלן זיך צוזאם צו מאכן די באוויסטע געדרייטע לייטער אויסשטעל.

Waukesha
שר חמישים ומאתים
תגובות: 339
זיך איינגעשריבען אום: מאנטאג דעצמבער 03, 2018 12:31 pm
לאקאציע: Waukesha City, Waukesha County WI

תגובהדורך Waukesha » דינסטאג אוקטובער 08, 2019 12:37 am

פדף ערשטע 4 תגובות, אביסל פארראכטען, און צוגעלייגט הערות.

DNA1-compressed.pdf
(125.81 KiB) דאונלאודעד 76 מאל

Waukesha
שר חמישים ומאתים
תגובות: 339
זיך איינגעשריבען אום: מאנטאג דעצמבער 03, 2018 12:31 pm
לאקאציע: Waukesha City, Waukesha County WI

סדר נחלות

תגובהדורך Waukesha » דאנארשטאג אוקטובער 17, 2019 2:39 am

ווי באקאנט טוהט יעדער מענטש ירשנ'ען געוויסע מדות (מדה מיין איך נישט דוקא מדות ווי רגזן, כעסן וכדומה, נאר אויך אנדערע וועגן ווי אזוי מען זעט א מענטש, ווי למשל אויגען קאליר, האר קאליר וכדומה) פון זיין טאטע, און געוויסע מדות פון זיין מאמע, אבער ווי אזוי פונקטליך ארבייט דאס? איז דא א סדר? אויב יא וואס איז די סדר? אט דאס איז די ציל פון דער תגובה. עס איז וויכטיג צו באטאנען, איז מען רעדט נאך נישט פון וויאזוי DNA שפילט א ראלע, נאר בלויז וואס איז די מציאות פון ירושה.

פאר בערך 150 יא צוריק האט א גוי מיטן נאמען Gregor Mendel, זיך גענומען שטאדירען די זאך, און ער איז ארויס געקומען מיט גאר א קלארע model, עס איז וויכטיג צו באטאנען אז מענדעל'ס סטודיס זענען געווען גאנץ שוואכע סטודיס, עס זענען אפילו דא מענטשען וואס טענה'ן אז גרויסע חלקים פון די סטודיס זענען געווען געפעלטש, אבער אעפ"כ איז זיין מאדעל א גוטע פלאץ אן צו הויבען, ווייל ע"פ רוב איז זיין model יא גערעכט, און מען קען שפעטער צולייגען ווי ער איז געוועהן נישט גערעכט.

לאמיר זען וואס ער האט געזאגט, ער האט שטודירט Peas, דהיינו אז ער האט גענומען 2 אנדערע סארט פיעס און עס מרכיב געוועהן איינעם צום צווייטען, און דערנאך זיי צוגעשטעלט צו זען מיט וואס ענדעלט די נייע פרי מיט די צוויי עלטערען, מיט וואס ער ענדעלט צו דעם, און מיט וואס ער ענדעלט צום אנדערען. ער האט שטודירט 7 מדות, אבער דא וועלען מיר בלויז רעדען פון 1, דהיינו די קאליר פון די פרי. ער האט גענומען א גרינע pea און עס מרכיב געוועהן מיט א געלע pea, און געקוקט אויף די פירות חדשים.

לאמיר זיך אפשטעלען א רגע, און טראכטן וואס וואלטן מיר זיך פארגעשטעלט אז ער האט געטראפען, מען קען טראכטען אז די נייע זענען געוועהן ארגעץ אינצעווישען גרין און געל, אדער קען מען טראכטען אז בערך האלב זענען געוועהן גרין און האלב זענען געוועהן געל, בערך אזוי האט אויך מענדעל געמיינט אז ער וועט טרעפען, אבער צו זיין שטוינענג האט ער געטראפען אז אלע נייע peas זענען געווען געל! וועלענדיג בעסער פארשטיין וואס גייט פאר, האט מענדעל גענומען די דור שני peas, און עס מרכיב געוועהן איינער מיט'ן צווייטען.

לאמיר נאכאמל טראכטען, וואס מיינט מען אז ער האט געפונען? והלא דברים ק"ו אויב די ערשטע דור האט ער מרכיב געוועהן גרין און געל, און דור שני זענען אלע געוועהן געל, דור שני מיט דור שני, וואס ביידע זענען געל, איז דאך זיכער אז די דור שלישי וועט זיין אלע געל. אזוי אויך איז געוועהן מענדעל'ס געדאנקען גאנג. אבער וואונדער איבער וואונדער דור שלישי זענען 75% געוועהן געל, און 25% גרין! דאס האט שאקירט מענדעל. ווי קען זען אז ווען ער האט מרכיב געוועהן גרין מיט געל זענען אלע געוועהן געל, אבער די דור שני מיט דור שני האבן געהאט 25% גרין? נאך מער אויב ביידע peas פון וואס דער דריטע דור איז מורכב פון זענען געל, פון ווי קומט די גרינקייט פון דעם דריטן דור?

כדי צו פארענטפערען די קשיות איז מענדעל אויפגעקומען מיט א טעריע, די טעריע גייט אזוי, עס איז דא זאכען וואס יעדער צומח חי מדבר האט, וואס הייסען genes. יעדער gene איז ממונה אויף אן אנדערען מדה, אין אונזער משל איז דא א gene וואס איז ממונה אויף די קאליר פון די פרי. און פון יעדען gene קען זיין מערערע סארטן (שפעטער האט מען דאס א נאמען געגעבען allele). דהיינו אז עס איז דא 2 סארטן פון די gene וואס איז ממונה אויף קאליר פון די pea. איין סארט מאכט גרין און די אנדערע סארט מאכט געל.

די עיקר חידוש פון זיין תירוץ איז געוועהן, אז די pea פרי האט 2 סעטס פון genes, און ווען מען איז מרכיב 2 peas וועט די נעקסטען דור ירשנען איין סעט פון יעדען פון די 2 peas. און אונזער משל ווען מען איז מרכיב א גרינע און א געלע pea, וועט די נעקסטען דור האבן 1 גרינע gene, און 1 געלע gene. דאס פירט צו זיין צווייטען חידוש, אז ווען א פרי האט 2 genes וואס יעדער איינער פון די צוויי איז אן אנדערען סארט, וועט איין סארט (דער dominant) גובר זיין אויפן צווייטען סארט (די recessive). אין אונזער דוגמא איז געל די dominant וואס איז גובר אויף די גרין וואס איז recessive.

יעצט לאמיר זען אויב די קשיות זענען פארענטפערט, דור שני peas האבן אין זיך איין גרינע gene און איין געלע gene. (דאס איז מוכרח, ווייל ער באקומט איינס פון יעדער עלטערען, און דא האט ער געהאט איין עלטערען מיט בלויז גרינע genes, און איין עלטערען מיט בלויז געלע genes) ממילא ווען מען איז מרכיב צוויי דור שני'ס קען זען 4 מעגליכקייטען 1) ער וועט ירשנען פון די ערשטע די גרינע gene און פון די צווייטע די גרינע - קומט אויס סוף דבר אז די פרי וועט זיין גרין. 2) גרין פון די ערשטע, געל פון די צווייטע - סוף דבר- א געמיש די געל איז dominant די פרי איז געל 3) געל פון די ערשטע, גרין פון די צווייטע - סוף דבר - א געמיש = געלע פרי 4) געל פון די ערשטע, געל פון די צווייטע -סוף דבר- געל. ווי מען קען זען איז בלויז און איינער פון די 4 פעלער וועט זיין א גרינע פרי, שטימט זייער פיין אז 25% פון דור שלישי איז געוועהן גרין.

בנוגע זיין צווייטע קשיא, הגם עס ווערט גאר פשוט פארענטפערט, האט ער געזאגט אז די recessive gene איז א באהלטענע gene, דהיינו אז עס איז דא די גרינע gene, נאר עס איז באהאלטען, ווייל מען זעט נישט די תוצאות פון די gene. היינט צו טאגס איז מער באקאנט די נאמען carrier פאר איינער וואס האט א באהאלטענע gene, ווייל כאטש ער אליינס האט נישט די מדה, קען ער פארט דאס איבערגעבען פאר זיינער קינדער.

די טערמין carrier, ווערט מערסטענס באנוצט מיט מחלות, די סיבה דערפאר איז ווייל רוב פארשעריי וואס מען מאכט אין דעם פעלד פון ירושה, איז פאר מחלות, און ווי מען קען דאס פארמיידען, אבער די אמת איז אז פאר יעדען מדה איז שייך צו זאגן אז ער איז א carrier. פארשטייט זיך, אז כאטש וואס מענדעל האט שטודיריט בלויז peas, האט ער געהאלטען אז די זעלבע איז אמת, ביי א יעדע זאך מצומח ולמעלה, פון הייווען בוז די מענטש.

לאמיר געבן אפאר משלים כדי צו בעסער ארויס האבן די model. איך וועל נישט שרייבן בנוגע א סעפיציפשען מדה נאר איך וועל שרייבן ר פאר recessive און ד פאר dominant. און מען קען אליינס עס אויסטוישען פאר וועלעכן מדה מען וויל, ווייל יעדער מענטש האט צוויי genes, פעלט אויס 2 אותיות פער מענטש, די מענטש וועט נאר האבן די recessive מדה אויב איז ער "רר"

1. טאטע = רר מאמע = רר קינדער = רר
2. טאטע = רד מאמע = רר קינדער = 50% רד, 50% רר
3. טאטע = רד מאמע = רד קינדער = 25% רר, 50% רד, 25% דד (דריטע דור פון מענדעל)
4. טאטע = דד מאמע = רר קינדער = רד (צווייטע דור פון מענדעל)
5. טאטע = דד מאמע = רד קינדער = 50% רד, 50% דד
6. טאטע = דד מאמע = דד קינדער = דד

מיט א שנעלן בליק קען מען זעהן אז אויב איינער פון די 2 עלטערען האבן 2 דאמיניט genes (שורות 4,5,6) וועט די קינד האבן עכפ איין דאמיניט, און וועט האבן די דאמיניט מדה, אז מען טראכט אביסל אריין פארשטייט מען עס אויך גלייך, היות מען באקומט איין סעט פון genes פון יעדער עלטערען, און איין עלטערען האט דאך נאר די דאמיניט gene, ע"כ וועט די קינד אויך האבן די דאמיניט gene.

זייטיגע נאטיץ
צום שלוס לאמיר מאכן א שטיקל דיקטשינערי, סיי פון ווערטער וואס איך האב שוין גענוצט און סיי נייע ווערטער

gene = עפעס (ביז דערווייל נישט געשמועס פון וואס דאס איז געמאכט) וואס איז ממונה אויף א מדה (למשל פרי קאליר), און גייט אריבער מדור דור
allele = א סארט gene וואס טוהט די תפקיד וואס די gene דארף טוהן אין איר אייגענארטיגע וועג (למשל גרין פרי קאליר)
trait = מדה
genotype = ביידע סארטן פון א gene וואס א זאך פארמאגט, למשל די פרי האט 1 גרין allele און 1 געלע אדער די פרי האט 2 גרינע alleles
heterozygous = ווען א צומח ולמעלה פארמאגט 2 אנדערע alleles פאר איין gene למשל גרין און געל
homozygous = ווען א צומח ולמעלה פארמאגט די זעלבע allele אין ביידע סעטס פון genes. למשל 2 גרין alleles, אדער 2 געלע
לעצט פאראכטן דורך Waukesha אום מיטוואך אוקטובער 23, 2019 2:31 pm, מאל פאראכטן געווארן 1 סך הכל.

ראש_חודש
אנשי שלומינו
תגובות: 5
זיך איינגעשריבען אום: דאנארשטאג דעצמבער 06, 2018 10:04 pm

תגובהדורך ראש_חודש » דאנארשטאג אוקטובער 17, 2019 10:29 pm

Wow ישר כח זייער גיט מסביר געווען !!
אויב מעגלך גיי אויך אין the technical חלקים ווי אזוי דאס ארבעט.

איפה פייביש
שר חמש מאות
תגובות: 804
זיך איינגעשריבען אום: דינסטאג יולי 09, 2013 10:39 pm

תגובהדורך איפה פייביש » פרייטאג אוקטובער 18, 2019 12:56 pm

Wow זייער זייער אינטערסאנט!! ישר כח גדול! זייער קלאר געשריבן נאך קיינמאל נישט אזוי גוט פארשטאנען!

נישט צום גלייבן די נפלאות הבורא!

אפשר וואלט געווען כדי צו בעטן הרב "איינס" צו איבערשרייבן אלעס מיט בילדער אזוי ווי ער גוט מיט די ארץ ישראל אשכול.

viewtopic.php?f=3&t=40176

Waukesha
שר חמישים ומאתים
תגובות: 339
זיך איינגעשריבען אום: מאנטאג דעצמבער 03, 2018 12:31 pm
לאקאציע: Waukesha City, Waukesha County WI

וואס איז א gene?

תגובהדורך Waukesha » מוצ"ש אוקטובער 26, 2019 10:26 pm

אין די פריערדיגע תגובה, האבן מיר אוועקגעשעלט אז עס איז דא א זאך וואס הייסט א gene, אבער מיר זענען נישט אריין פון וואס די gene באשטייט פון. וואס ווייסען מיר פון דעם
gene?

1. יעדער gene איז ממונה פאר זיין תפקיד
2. מענדעל זאגט אונז אז יעדער פארמאגט 2 פון יעדען gene
3. די gene גייט אריבער מדור דור

פאר מיר גייען ענטפערען די שאלה, וואלט כדאי געוועהן אביסל מער מרחיב זיין אין די נושא פון פראטיען. איך האב שוין געשריבען אז רוב פראטיענס זענען ענזיימס, דא האב איך געשריבען איבער ענזיימס.

עס איז באקאנט אז יעדער זאך און די גוף באשטייט פון cells, לדוגמא אן אויג, איז צוזאמגעשטעלט פון אויג cells, די הויט, פון הויט סעלס, אזוי אויך בלוט, האר, נעגעל וכדו', אזוי אויך אלע איברים הפנימיים, אזוי ווי די הארץ, די לונגען, די לעבער וכדו' זענען צוזאמגעשטעלט פון ספיעצילע סעלס. יעדער פון די איברים האט זיך זיין תפקיד, און יעדער פון די סעלס פון וואס די איברים באשטייעט פון, טוהט זיין חלק כדי אז די אבר זאל טוהן וואס עס דארף טוהן.

איינער פון די וויכיטיגסטע אויפגאבעס וואס א סעל האט, איז צו מאכן פראטיענס, וואס די פראטיענס וועלן ענדגילטיג טוהן וואס די אבר דארף אויפצוטוהן, למשל איינער פון די ענזייעמס וואס ווערען פרודיצירט דורך די pancreas הייסט Amylase, די תפקיד פון דעם ענזיים איז צו צוברעכען קארבאהיידרייעטס און starch, און מאכן דערפון צוקער, דאס העלפט די pancreas אויף טוהן זיין חלק אין פארדייען עסן. אלע אברים מאכן אנדערע סארט פראטיענס, לויט וואס עס פעלט זיך אויס פאר זיין אבר, די הארץ מאכט די פראטיען וואס ער דארף, די לונגען וואס ער דארף וכו' וכו'. נאך א וויכטיגע יסוד, קיין שום סעל וועט נישט מאכן קיין פראטיען וואס ער דארף נישט, דהיינו, אז א לונגען סעל וועט נישט מאכן א פראטיען וואס פעלט זיך אויס בלויז פאר די הארץ, וכן להיפך.

מיר האבן אין די פריערדיג'ע תגובה גערעדט איבער געוויסע מדות, ווי למשל קאליר פון האר, די אמת איז אז עס איז פארהאן א סארט סעל וואס הייסט Melanocyte, וואס איהר תפקיד איז צו מאכן melanin (די melanin איז די עיקר גורם פון די קאליר פון האר) , און זי טוהט דאס מאכן מיט די הילף פון אסאך פראטיענס, טוישען אין געוויסע פון די פראטיענס איז די גורם אז די melanin זאל זיין אנדערש, וואס דאס איז גורם אז די קאליר פון די האר זאל אויך זיין אנדערש. כמעט אלעס אין די גוף ווערט געפירט דורך די פראטיענס, און זיי זענען די גורמים פאר כמעט אלע מדות וואס א מענטש האט.

צוליב די פילע זאכן אויף וואס פראטיען איז אחראי אויף, האבן סייענטיסען גלייך געשריגען אז אונז ווייס מיר וואס די gene איז! דאס איז די פראטיען! ווי ווייסען מיר דאס? ווייל מיר ווייסען אז כמעט יעדער תפקיד וואס פעלט אויס צו געשען אין די גוף ווערט געטוהן דורך פראטיענס, איז טייטש אז די פראטיענס זענען ממונה אויף די מדות. ממילא אז סימן 1 פון די gene ווייזט אויף די פראטיענס, בליייבט נאר איבער צו פארשען וויאזוי פראטיענס גייען . מען האט געפראשעט און גפארשעט און מען האט נישט געקענט אויסרעכענען וויאזוי פראטיענס קענען גיין מדור לדור.

כדי צו פארשטייען וואס די פראבלעם מיט זאגן אז פראטיען גייט אריבער מדור לדור פעלט זיך אויס א שטיקעל הקדמה, לאמיר צוריקגיין צו אונזער משל מיט די Pea, און מיר וועלן פרובירען מסביר זיין וויאזוי עס וואקסט פון א pea נייע דורות, די pea מאכט pollen, ווי אויך מאכט די pea א בלום. ווען עס קומט זיך צוזאמען די pollen און געוויסע חלקים פון די בלום, וועט ווערען דערפון א קערעלע, מען פלאנצט איין די קערעלעך און פון דעם וואקסט נייע peas, וואס זיי מאכן אויך בלומען און פאללען וחוזר חלילה נאך און נאך דורות.

פון די קערעלע וואקסט א גאנצע pea. סיי די בלום, סיי די שאכטעל און וואס די פרי קומט אין, סיי די ספיעציעלע חלקים פון די בלום וואס פעלט אויס צו מאכן נייע דורות, און סיי די פאללען, יעדעס איינציגיסטע זאך וואס איך האב דא אויסגערעכענט באשטייט פון סעלס, און ווי פריער אויסגעשמועסט באשטייט יעדער זאך פון אנדערע סארט סעלס, און יעדער סעל מאכט נאר די פראטיענס וואס פעלט זיך אויס, און אין אונזער משל וועט די שאכטעל נישט מאכן די פראטיענס וואס פעלט זיך אויס פאר די בלום

יעצט מיר האבן געזאגט אז די סדר פון וואס איין pea ווערט א דור פון נאך peas איז אזוי 1. עס איז דא פאללען 2. דא פאללען שטעלט זיך צוזאם מיט געוויסע חלקים פון די בלום 3. עס ווערט פון דעם א קערעלע 4. עס וואקסט פון די קערעלע א גאנצע pea, האבן מיר דא 3 סארטען סעלס, פאללען, בלום חלק, קערעלע, יעדער פון די סעלס מאכט נאר די פראטיען וואס ער דארף, דהיינו די פאללען מאכט נישט קיין פראטיען וואס פעלט אויס פאר די קערעלע, און די בלום חלק מאכט אויך נישט קיין פראטיען וואס פעלט אויס פאר די קערעלע, אם כן, פון ווי נעמט די נייע קערעלע סעל, די אונסטריקציעס וויאזוי צו מאכן די פראטיען וואס פעלט אויס בלויז פאר די קערעלע?

אין די אינעוועדיגסטע חלקים פון די סעל, געפינט זיך דארט א זאך וואס פאר יארן לאנג האבן סייענטיסיען געהאלטן אז דאס איז garbage. זיי האבן געהאלטען אז די סעל דארף דאס נישט און עס טוהט גאר נישט אויף, די אייניצגסטע אינטראסאנטע זאך וואס דאס האט, איז אז דאס איז קאלירט, די סייענטיסען האבן מחליט געווען צו רופן די זאכן "קאלירטע זאכן" אדער וויאזוי מען זאגט דאס אין לייטעניש chromosomes...

אין 1928 האט א סייענטיסט געמאכט אן עקספערימענט, און געזאגט אז די עקספירעמענט ווייזט אז די chromosomes, וואס מען שרייט ביז היינט אז זיי זענען garbage, זיי זענען גאר די genes. בליץ שנעל זענען געקומען אלע סייענטיסען און אפגעלאכט פון עם, זיי האבן געשריגען אז ער האט זיכער געמאכט א טעות, אין 1944 האט זיך נאכאמאל איבערגשפילט די זעלבע מעשה, דאס מאל האבן די סייענטיסען וואס האבן געמאכט די עקספירימענט, אויך געווען זיכער אז עפעס א טעות האבן זיי געמאכט, אבער צוביסליך האבן מער און מער סייענטיסטען אנגעפאנגען חושד זיין אז אפשר איז די chromsome יא די gene, און 1952 האט מען געמאכט נאך אן עקספערימענט, כדי אויסצוגעפינען ענדגילטיג אויב genes זענען געמאכט פון chromosomes אדער נישט, די רעזולטאטען זענען געווען קלאר, די chromosomes, נישט די פראטיען, זענען די genes.

אין די קומענדיגע תגובה וועל איך מסביר זיין וויאזוי די chromosomes וואס באשטייט גענצליך פון DNA, שטימט מיט די 3 סימנים וואס מיר האבן געגעבען אויבען אז די gene מוז האבן.

Waukesha
שר חמישים ומאתים
תגובות: 339
זיך איינגעשריבען אום: מאנטאג דעצמבער 03, 2018 12:31 pm
לאקאציע: Waukesha City, Waukesha County WI

DNA צו פראטיען

תגובהדורך Waukesha » מוצ"ש נובעמבער 02, 2019 10:23 pm

ווי מען האלט יעצט, ווייסען מיר אז כמעט אלע תפקידים וואס פעלט זיך אויס פארן גוף, פון פארדייען עסן בוז מאכן די האר קאליר, ווערט געטון דורך פראטיענס. מיר ווייסן אויך אז דאס אריבערגיין פון דור צו דור ווערט געטון דארך DNA chromosomes.

מען קען זיך אפשטעלן און פרעגן א פראגע, ווי אזוי? אויב למשל די עלטערן האבן אין זיך פראטיענס וואס מאכן שווארצע האר, גייט דאך נישט איבער די פראטעין צום קינד, בלויז DNA גייט אריבער, וואס אין די DNA איז גורם אז די פראטיען וואס די גוף פון די קינד מאכט זאל אויך מאכן שווארצע האר?

די תי' איז אז DNA איז א code פאר די גוף, די גוף לייענט די קאוד, און לויט די קאוד ווערט געמאכט נייע פראטיענס. מען קען זיך פארשטעלן ווי דאס איז קאמפיוטער קאוד, די גוף איז ווי א קאמפיוטער, און די פראטיענס איז די תוצאות פון די פראגרעם.

וויאזוי ארבעט די קאוד? עס האט אין זיך 2 שטאפלען, 1. Transcription, אין דער שטאפל ווערט חלקים פון די DNA געלייענט, און ווערט איבערגעשריבן צו RNA. שטאפל 2. Translation. און דער שטאפל ווערט די RNA געלייענט, און ווערט איבערגעטייטשט אויף פראטיען.

וואס איז דאס RNA ? RNA איז גאר ענדלעך צו DNA. אין די תגובה ווי מען איז מסביר DNA, שטייט אז די רת פון DNA איז Deoxyribonucleaic acid, די רת פון RNA איז Ribonucleaic acid, דהיינו אז זיין רוקנביין באשטייט פון ribose וואס פעלט נישט קיין oxygen, און פארדעם הייסט ער Ribonucleaic און נישט ווי די DNA וואס זיין רוקנביין פעלט יא אן Oxygen, און פארדעם באקומט ער די שם לווי deoxy.

נאך א חילוק צווישן RNA און DNA, איז אז DNA קען האבן איינס פון 4 זייטיגע קייטען, ACGT ווי געשמועסט אין די DNA תגובה, RNA קען טאקע האבן די A, C און G זייטיגע קייטען, אבער ער קען נישט האבן די זייטיגע קייט thymine. אנשטאטס קען ער האבן א זייטיגע קייט וואס איז ענדליך צו thymine, וואס הייסט uracil. דאס ווערט קערצער געמאכט צו U. פונקט ווי T, וועט U אויך מאכן hydrogen bonds מיט A.

א דריטער חילוק צווישן DNA און RNA איז, אז DNA איז בדרך כלל double stranded, דהיינו אז עס קומט 2 מאליקיועלס צוזאמען איינס געדרייט ארום דעם צווייטן און קוקט אויס ווי א געדרייטע לייטער, אבער RNA איז בדרך כלל single stranded, דהיינו אז עס קומט בלויז איין מאליקיועל אויף א מאל.

ווען DNA ווערט איבערגעשריבן צו RNA ארבייט עס אזוי, עס וועט קומען אן ענזיים וואס הייסט RNA polymerase, און וועט זיך ארויף זעצן אויף די DNA, דארט ווי די צוויי זייטיגע קייטן קומען זיך צוזאם, דהיינו אויף דער טרעפ פון די לייטער, אויף די מיטעלע חלק פון די טרעפ, און ער וועט זיך נעמען ליינען איינער פון די זייטן, למשל אויב וועט ער ליינען די רעכטע זייט פון די לייטער, וועט ער קוקן וועלכע זייטיגע קייט ליגט אויף די רעכטער זייט פון די טרעפ אויף וואס ער טרעפט זיך יעצט, לאמיר זאגן אז עס איז א G, און ער וועט אויפזוכן אן RNA וואס זיין זייטיגע קייט מאכט hydrogen bonds מיט דער DNA זייטיגע קייט, אין אונזער פאל איז דאס די C, דערנאך וועט ער גיין צו די נעקסטע טרעפ, און וועט עס ליינען, לאמיר זאגן אז דאס איז אן A און ער וועט זיך אויפזוכן א RNA שותף פאר די A, וואס פאר RNA איז דאס U און ער וועט עס באהעפטן (דורך די רוקנביינער ) צו די C פון פריער, און ער וועט גיין צום נעקסטער און דער נעקסטער און אזוי ווייטער.

rna-polymerase-1.png
rna-polymerase-1.png (41.02 KiB) געזעהן 1688 מאל


לאמיר דא געבען א משל

CGGTAAGGTATCACTCAAGA - זייט פון DNA וואס ווערט געליינט
GCCATTCCATAGTGAGTTCT - זייט פון DNA וואס ווערט נישט געליינט
GCCAUUCCAUAGUGAGUUCU - ניי RNA

זייטיגע נאטיץ
אויב קוקט מען זעט מען אז די RNA איז כמעט די זעלבע ווי די זייט פון DNA וואס ווערט נישט געליינט, און אז מען טראכט אביסל פארשטייט מען אויך פארוואס, די סיבה איז גאר פשוט, סיי די RNA, און סיי די אנדערע זייט פון די DNA, באשטייען פון די שותפים פון די DNA וואס ווערט געליינט, צוליב דעם אויב איינער קומט און זאגט דא האסטו ביידע זייטען פון א chromosome, זאג מיר וואס די RNA וועט זיין אויב מען ליינט די רעכטע זייט, איז גרינגער צו קוקן אויף די לינקע זייט און בלויז טוישען די T's צו U, און נישט טראכטן וואס איז די שותף פון A? און דערנאך G?


יעצט האבן מיר שוין אן RNA און מען איז גרייט צו גיין צום נעקסטען שטאפל, Translation, און דער שטאפל וועלען קומען ribosomes, וואס וועלען נעמען די RNA און עס פארטייטשען צו פראטיען. דא ווערט אבער א פראבלעם, אנדערש ווי DNA און RNA, וואס ביידע האבן בלויז 4 זייטיגע קייטן, וואס דאס איז זייער גרינג צו טוישען איינער צום צווייטען ווייל יעדער איינס פון DNA האט א שותף אין RNA (דהיינו A ווערט U, די C ווערט G, די G ווערט C, און די T ווערט A) אבער די פראטיען ווי עס איז דא 20 אמינא אסידס, ווי אזוי קען מען פון 4 RNA וויסן וועלעכע אמינא אסיד צו לייגען? די תי' איז אז טאקע אנדערש ווי DNA צו RNA ווי יעדער DNA ווערט 1 RNA, ביי די פראטיען ווערט פון יעדער 3 RNA איין אמינא אסיד.

פארוואס 3? ווי געשמועסט דארף מען האבן קאודס פאר 20 אמינא אסידס, אויך דארף מען א קאוד פאר ווען די פראטיען איז פארטיג, דהיינו א קאוד וואס הייסט די ribosome אויף הערען צו לייגען מען אמינא אסידס, בסה"כ דארף מען 21 קאודס, אויב וועט מען מאכן קאודס פון בלויז איין RNA, וועט מען נאר האבן קאודס פאר 4 אמינא אסידס, אויב 2, וועט מען האבן גענוג קאודס פאר 16 אמינא אסידס (4 מאל 4), אבער מיט 3 קען מען האבן 64 קאודס, און דאס איז איבער גענוג פאר די 20 אמינא אסידס מיט די סטאפ, יעצט אבער קומט אויס אז מען האט 43 איבריגע קאודס, וואס געשען מיט די 43 קאודס? די תי' איז, אז עס זענען דא געוויסע אמינא אסידס וואס האבן מער פון איין קאוד, למשל די סטאפ קאוד, איז דא 3 קאודס UAG, UAA און UGA, געוויסע אמינא אסידס האבן 6 קאודס, און געוויסע האבן בלויז איינס. דא האב איך צוגעלייגט 2 וועגן צו זען וועלעכע קאוד גייט צו וועלעכע אמינא אסיד.

codon-table.png
codon-table.png (244.17 KiB) געזעהן 1688 מאל

codon-chart.jpg
codon-chart.jpg (54.27 KiB) געזעהן 1688 מאל


לאמיר איבערגיין אין איין שורה וואס גייט דא פאר, DNA ווערט איבערגעשריבען צו RNA, דערנאך וועט פון יעדער 3 RNA ווערען איין אמינא אסיד לויט די codons פון די אמינא אסידס און אזוי ווערט א פראטיען.

זייטיגע נאטיץ
צוויי זאכן האב איך געוואלט אויסשמועסן בדרך אגב

1. ווען איך זאג אז די DNA קאוד איז כעין א קאמפיוטער מיין איך עס גאר ערענסט, בשעת די צווייטע וועלט מלחמה האט א ענגלישע גוי מיט'ן נאמען Alan Turing געבויט די ערשטע קאמיפוטערס כדי צו ברעכען די דייטשע enigma קאודס, חוץ בויען די קאמפיוטער האט ער אויך געמאכט א ליסטע, וואס כדי אז א כלי זאל זיך קענען רופן אלץ א קאמפיוטער, מוז ער קענען טון די אלע זאכן אויף די ליסטע. כאטש וואס ער האט דאס געשריבן בשעת די מלחמה, און מען האט ערשט אויסגעפונען אז DNA איז די gene ערשט 7 יאר נאך די מלחמה, דאך ווי איך וועל אי"ה מסביר זיין אין די קומענדיגע תגובה, האט DNA אלעס וואס שטייט אויף די ליסטע.

2. די ribosome קומט זיך באמת א תגובה פאר זיך, דאס איז נישט בלויז איין פראטיען נאר דאס איז א machine, דאס איז צוזאמגעשעלט פון אפאר פראטיענס וואס ארבייטען צוזאמען. די סעל האט מאשינען וואס וואלטן זיך געקענט פארמעסטען מיט די גרעסטע פארבריקען, די ribosome, וואס באמת איז בלויז אן הכנה צו מאכן א פראטיען, איז בלויז איין דוגמא. ועוד חזון למועד.

מחשב
שר האלף
תגובות: 1476
זיך איינגעשריבען אום: דינסטאג יולי 17, 2018 3:57 pm

תגובהדורך מחשב » זונטאג נובעמבער 03, 2019 2:36 pm

WOWֱֱ! יישר כח! עמיר אפירזוכן אפאר איבעריגע מינוטן, און ליינען מיט ישוב הדעת.
הוי מחשב...

Waukesha
שר חמישים ומאתים
תגובות: 339
זיך איינגעשריבען אום: מאנטאג דעצמבער 03, 2018 12:31 pm
לאקאציע: Waukesha City, Waukesha County WI

כיצד נוחלין

תגובהדורך Waukesha » זונטאג דעצמבער 22, 2019 12:26 pm

ווי שוין געשריבן אין די פריערדיגע תגובה, איז DNA דאס וואס גייט אריבער פון דור צו דור, מיר ווייסען שוין אויך אז DNA אינהאלט אין זיך די אינסטרוקשעינס צו מאכן פראטיען. מיר האבן שוין אויך געשריבן אין דער תגובה די סדר פון די ירושה וואס מענדעל האט אוועקגעשטלעט און אויסגעפארשט. יעצט לאמיר זען צו DNA שטימט טאקע מיט די סדר ירושה וואס מענדעל האט אוועקגעשטעלט. מיר וועלען זיך אוועקשטעלן אויף זיינע יסודות איינס ביי איינס און זען טאמער עס שטימט.

איינער פון די יסודות וואס מענדעל לייגט אראפ, איז אז פון יעדען gene באקומט מען צוויי, איינס פון יעדער עלטערען. שטימט דאס מיט DNA? די תירוץ איז נישט אזוי פשוט. עס איז פארהאן אין די מענטש 3 סארט DNA.

סארט 1. autosomal choromsomes. דהיינו קראמאסאומס, וואס קומט 2 אין א פאר, איינס קומט פון די מאמע און איינס פון די טאטע. מענטשען האבן אין זיך 22 אזעלכע קראמאסאומס.

סארט 2. די Y קראמאסאום, דאס איז א קראמאסאום וואס זיין שותף איז נישט די זעלבע ווי ער, נאר זיין שותף איז די X קראמאסאום. די Y קראמאסאום געפינט זיך בלויז ביי מענער, פרויען האבן 2 X קראמאסאומס.

סארט 3. cytoplasm DNA. דאס איז קליינע שטיקלעך DNA וואס געפונען זיך נישט אין די זעלבע פלאץ ווי די קראמאסאומס (די קראמאסאומס געפונען זיך און די אינעווענדיג אדער nucleus פון די סעל, די קליינע שטיקליך ליגן אין די cytoplasm layer פון די סעל), און האבן נישט קיין שותף, זיי גייען איבער בלויז פון די מאמע צו די קינדער. די גרעסטע און וויכטיגסטע פון די cytoplasm DNA (אדער cpDNA אין קורץ) איז mitochondria DNA. אסאך מאל ווען מען רעדט פון cytoplasm DNA וועט מען נאר דערמאנען די mitochondria DNA (אדער mtDNA אין קורץ).

ווי מען קען זען אז בלויז די ערשטע סארט DNA שטימט מיט מענדעל'ס גאנג, אבער די אנדערע 2 סארטען שטימט נישט בכלל מיט מענדעל. און די אמת איז ווי געשריבען אויבען האט מענדעל בלויז געקוקט אויף 7 מדות פון די pea. די Pea האט אין זיך 7 autosomal chromosomes. אלע 7 מדות טרעפען זיך אויף די 7 קראמאסאומס (יעדער איינער פון די מדות איז אויף אן אנדערע פון די 7 קראמאסאומס). די אמת איז אז די 22 autosomal קראמאסאומס אנהאלטען כמעט 3 ביליאן פארען פון DNA, משא"כ די Y אנטהאלט בלויז 58 מיליאן, און mtDNA האט בלויז 16,500 פארען פון DNA. דאס מיינט אז פאר 95% פון DNA איז מענדעל גערעכט געווען אבער פאר 5% איז ער נישט געווען גערעכט.

עס פעלט זיך אויס אביסל מער אויסצושמועסן איבער די Y DNA, די Y DNA האבן בלויז מענער, פרויען האבן נישט קיין Y DNA, אנשטאט דעם האבן זיי 2 X DNA, דאס מיינט אז א מאן וועט ירשנען זיין Y פון זיין טאטע (די מאמע האט דאך נישט קיין Y אז די זין זאל קענען נעמען) אבער זיין X וועט קומען בלויז פון זיין מאמע. פונקט ווי ביי אלע אנדערע קארמאסאומס באקומט מען איינס פון די פאר פון די טאטע, און איינס פון די פאר פון די מאמע, אזוי אויך ביי די XY פאר, איינס פון די טאטע, און איינס פון די מאמע. און ווייל די Y קומט פון די טאטע, מוז די X קומען פון די מאמע, פרויען באקומען 2 X קראמאסומס, איינס פון די טאטע (וואס ער האט באקומען פון זיין מאמע), און איינס פון די מאמע.

יעצט אז מיר ווייסען שוין די 3 סארטען DNA, פעלט זיך אויס מער מרחיב צו זיין אין די סדר פון די ירושה פון די 3 סארטען DNA, סארט 1, האבן מיר שוין קלאר ארויסגעברענגט מענדעל'ס מהלך אין דעם, און ביי דעם איז ער מער ווייניגער גערעכט (מיר וועלען נאך אביסל צונעמען דעם מענדעל אין א שפעטערע תגובה). סארט 3, איז גאנץ א פשוטער סדר, אויב די מאמע האט א מדה וואס טרעפט זיך אויף די mtDNA וועלען אירע קינדער 99.99% האבן דעם מדה. און איהרע טעכטער וועלען עס איבערגעבן פאר זייערע קינדער עד סוף כל הדורות (דאס איז גאר ניצלעך ווען מען וויל אוועקשטעלען א יחוס פון בת אחר בת ווי למשל יחוס ישראל). די ירושה פון די Y איז אויך גאנץ פשוט, עס גייט מאב לבן, און אויב א מאן האט א מדה וואס טרעפט זיך אויף די Y קראמאסאום וועט ער דאס 99.99% איבערגעבן פאר זיין זון, און ער פאר זיין זון עד סוף כל הדורות (דאס איז ניצלעך ווען מען וויל אוועקשטעלען א יחוס פון בן אחר בן ווי למשל כהן אדער לוי).

ווי זאכן ווערען אבער מער קאמפליציערט איז די X קראמאסום. פרויען האבן דערפון 2, און מענער בלויז 1, קומט אויס אז די סדר פון די ירושה פון א מדה וואס טרעפט זיך אויף די X קראמאסאום איז אנדערש ביי מענער און ביי פרויען, עס איז אויך אנדערש פון וועם מען ירשנ'ט עס. לאמיר זיך אוועקזעצן און שטאטלעך דורך טוהן די זאך. איבער צו פרישען די זכרון אביסל dominant מיינט א מדה וואס דארף בלויז איין פון די 2 קאפיס פון DNA זאל עם האבן כדי אז עס זאל זיך ארויסווייזען, איך וועל ניצען ד פאר dominant און ר פאר recessive

1. טאטע ד מאמע רר = זין האבן ר, טעכטער האבן רד = טאטע האט די ד מדה, טעכטער האבן די ד מדה (ווייל זיי באקומען עכ"פ איינס פון די X פון די טאטע, און די מדה איז א dominant, וואס פעלט נאר אויס איינס) זין האבן די ר מדה (ווייל זיי באקומען זייער X פון די מאמע)
2. טאטע ר מאמע רר = זין האבן ר, טעכטער האבן רר = טאטע מאמע טעכטער זין אלע האבן די ר מדה
3. טאטע ר מאמע דד = זין האבן ד, טעכטער האבן רד = טאטע האט ר מדה, מאמע האט ד מדה קינדער האבן אלע ד מדה
4. טאטע ד מאמע דד = זין האבן ד, טעכטער האבן דד = טאטע מאמע קינדער האבן אלע ד מדה
5. טאטע ר מאמע רד = זין האבן 50% ר און 50% ד, טעכטער האבן 50% רר און 50% רד = טאטע האט ר מדה, מאמע האט ד מדה, טעכטער און זין האבן 50% ר און 50% ד, געוואנדען לויט וועלעכע X מען באקומען פון די מאמע
6. טאטע ד מאמע רד = זין האבן 50% ר און 50% ד, טעכטער האבן 50% דד און 50% רד = טאטע האט ד מדה, מאמע האט ד מדה טעכטער האבן ד מדה, זון האבן 50% ד און 50% ר

לאמיר אנכאפען א משל, לאמיר נעמען די מחלה hemophilia, דאס איז א מחלה וואס מאכט זיך ביי געוויסע מענטשען אז ווען זיי צושניידען זיך וועט די בלוט גאנץ שטייט פארגליווערט, און דאס איז גורם אז זיי זאלן שטארק בלוטן פון יעדען שניט. די מחלה קען זיך געפינען אויף די X קראמאסאום און עס איז recessive. יעצט לאמיר זיך פארשטעלען א ציור, ווי נומער 5, דהיינו אז די טאטע האט די געזונטע ר allele, און די מאמע האט איינס און איינס, אירע טעכטער וועלן אלע זיין געזונט ווייל זיי גייען באקומען עכ"פ איין געזונטע פון זייערע טאטע, און 50% פון די זין וועלען האבן די מחלה און 50% פון די זין וועלען זיין געזונט.

פארשייט זיך אז איינער וואס ליידט אויף די מחלה קען מען נישט מאכן קיין ברית, ווייל ער קען אויסבלוטן די גאנצע בלוט ח"ו, מיר זעען אין די גמ' (יבמות סד:) אן איטרעסאנטע זאך, אז א פרוי וואס 2 פון אירע שוועסטערס האבן געהאט 2 קינדער וואס זענען מתו מחמת מילה, זאל זי נישט מאכן קיין ברית פאר איהר קינד. יעצט האט מען אביסל א פשט אין דעם גמ' וויבאלד די פרוי האט נישט די מחלה, און איהרע זין האבן יא די מחלה, מוז זיין אז זי האט איין געזונטע און איין נישט געזונטע, קומט אויס אז איהר שוועסטער, קען אויך גאנץ מעגליך האבן איין נישט געזונטע, און דעריבער זאל זי נישט מאכן קיין ברית פאר איהר קינד ווייל אפשר וועט זי איבערגעבן איהר נישט געזונטע צו איהר קינד, און ער וועט שטארבען מחמת מילה

הבהרה די אלע זאכן וואס איך האב געשריבן בנוגע די תורה, הן די פשט און מתו אחיו מחמת מילה הן בנוגע ניצען DNA אוועקצושטעלן סיי וואס פאר א יחוס, איז געשריבן געווארען סתם נקודות למחשבה, עס איז נישט אפילו בגדר פון להלכה ולא למעשה, זיי זענען פשוט'ע נקודות למחשבה. די סארט זאכן דארף מען פרעגען א דעת תורה, און לגבי יחוס דאכט זיך אז עס שוין דא תשובות פון גדולי עולם אז מען קען זיך נישט פארלאזען אויף DNA ואדרבה אז איינער קען מיר צוצייכענען תשובות וועגען דעם וואלט איך מיך זייער געפרייעט.

אוועטאר
מים חיים
שר חמישים ומאתים
תגובות: 347
זיך איינגעשריבען אום: דאנארשטאג יולי 14, 2016 12:08 pm

תגובהדורך מים חיים » זונטאג דעצמבער 22, 2019 1:05 pm

Waukesha האט געשריבן: אז איינער קען מיר צוצייכענען תשובות וועגען דעם וואלט איך מיך זייער געפרייעט.

גלאזער
שר האלף
תגובות: 1768
זיך איינגעשריבען אום: מיטוואך אוגוסט 12, 2015 11:25 pm

תגובהדורך גלאזער » זונטאג דעצמבער 22, 2019 1:49 pm

שיינע ביאורים
אז דו קענסט דיך יא אויס.
אפשר ביסטו מסביר די אלע חילוקים צווישן פארשידענע ydna טעסטס.
ס'דא 12. 25. 37 און אזוי ווייטער.
און וואס מיינט mutations. וויאזוי ווערט צוביסלעך אפגערוקט genetic matches
יישר כח

נא_שכל
שר חמשת אלפים
תגובות: 5113
זיך איינגעשריבען אום: מאנטאג יולי 14, 2008 10:44 pm
לאקאציע: עולם הדמיון

תגובהדורך נא_שכל » זונטאג דעצמבער 22, 2019 3:29 pm

מים חיים האט געשריבן:
Waukesha האט געשריבן: אז איינער קען מיר צוצייכענען תשובות וועגען דעם וואלט איך מיך זייער געפרייעט.

איך האב א ספר "בירורי יהדות לאור מחקר גנטיים", פון צוויי רבנים, בשיתוף מיט אידישע חוקרים. די עיקר פונעם ספר איז אויב מ'קען באשטעטיגן אז מ'איז א איד דורך בודק זיין און צוגלייכן די מיטוכנדריה פון א קינד צו די מאמע, וואס דאס גייט אריבער דורך די מאמע. כ'מיין אז זיי בלייבן להלכה פון כמה רבנים מומחים בענינים אלו, אז מ'קען זיך סומך זיין אויף DNA אלס א "סימן בינוני", נישט א סימן מובהק.

איינע פון די מחברים פון די ספר שרייבט אביסל איבער דעם ענין דא
"ואומר לאשר יבוא מכתבי לחזות, אכול את המגילה הזאת. כי מהאוכל יצא מאכל, ושכל יצא משכל ..." (ר' ברכיה בן נטרונאי הנקדן, בהקדמת ספרו 'משלי שועלים').

נא_שכל
שר חמשת אלפים
תגובות: 5113
זיך איינגעשריבען אום: מאנטאג יולי 14, 2008 10:44 pm
לאקאציע: עולם הדמיון

תגובהדורך נא_שכל » זונטאג דעצמבער 22, 2019 3:36 pm

א פסק פון די בית דין פון הגר"ש וואזנער ז"ל, און פון יבלחט"א הגרז"נ גולדבערג שליט"א

זיהוי גנטי (בדיקת DNA) לאור ההלכה
מאת הרה"ג הרב יעקב רוז'ה שליט"א, רב יחידת זק"א תל אביב

לאחרונה היו מספר אירועים קשים שבהם נהרגו מספר אנשים יחדיו. בחלק מאירועים אלה, הגופות היו במצב, שלפי ההלכה אין תוקף לזיהוי על סמך הכרות אישית של הפנים. ולכן הזיהוי נעשה על סמך המטען התורשתי = DNA = דנ"א.

המטען הגנטי

המטען התורשתי הוא ייחודי לכל אדם, והוא מהווה כעין 'תעודת זהות' ביולוגית.

הסיכוי שלשני בני אדם יהא אותו הרכב של דנ"א הוא אחד ל-30 מיליון.

בעזרת מיפוי הדנ"א ניתן לזהות בני אדם, שכן הדנ"א מהווה 'טביעת אצבעות' ייחודית לכל אדם.

הזיהוי הגנטי יכול להיעשות אפילו מקטע קטן של רקמה כלשהי, כגון שיער, טיפת דם, שכבת זרע, או קטע של עור. הזיהוי הוא בוודאות קרובה ל-100%,

כדי להשתמש בדנ"א למטרות זיהוי של גופה, יש לקחת מהגופה טיפת דם, להפיק מחומר זה את הדנ"א של הגופה ולהשוות את הדנ"א מגופה הנבדקת לדוגמת דנ"א שידוע שמקורו באדם הנעדר.

אם אין חומר שידוע שהוא מאדם הנעדר, יש אפשרות להעזר לצורך זיהוי בדוגמאות דם מהוריו של הנעדר או מצאצאיו.

פסקי הלכה

פסק של בית הוראה בראשות הגר"ש ואזנר שליט"א: (נמצא תחת ידי)

"על דבר השאלה האם אפשר להתיר עגונה מכבלי העיגון על סמך בדיקה זו? באופן כללי יש להבדיל בנידון זה בין בדיקת דנ"א, שיש התאמה בגוף האדם מעצמו לעצמו, לבין התאמה בין גוף האדם הנעדר לבין הוריו וצאצאיו. בדיקה בגוף האדם מעצמו לעצמו הינה יותר מגדר סימן בינוני, וקרובה לסימן מובהק. אמנם אין לסמוך אך ורק על בדיקה זו, אלא אם כן יש רגלים לדבר וצדדים נוספים עפ"י הלכה. אבל בדיקת דנ"א,שבה נעשית התאמה בין גוף הנעדר היא סימן בינוני.

כל הנ"ל נכתב ע"פ דעתו של מו"ר מרן הגר"ש ואזנר שליט"א

כמו כן הדברים אושרו ע"י הגר"נ קרליץ שליט"א

על החתום : הרב משה קליין

הרב זלמן נחמיה גולדברג שליט"א (תחומין / כרך כג):

"בדיקת DNA נראה שנחשבת כסימן מובהק, שהרי כאמור לעיל הסיכוי למציאת אדם בעלי סימני זיהוי דומים הוא אחד מתוך עשרה בליון. אלא שיש מי שטוען, שהבדיקות לא נעשו בכל האנשים שחיו מאז ימות האדם הראשון. לענ"ד אעפ"כ סומכין על זה. תדע, שהרי סומכין על טביעת עין מכח ההנחה שאין פרצופיהן של אנשים דומים זה לזה. ומנין לנו זאת? וכי נסעו בכל העולם ובדקו את כל האנשים וראו שאין שני אנשים דומים?! אלא על כרחך שסמכו על כך שרואים הרבה אנשים, ומתוכם לא נמצאו שנים דומים. אין זה אלא שכך ברא הקב"ה את בריותיו, שיהיו פרצופיהם שונים זה מזה".

כאמור באשר לבדיקת DNA נחלקו הדעות - לדעת בית דינו של הגר"ש וואזנר, כשההשוואה נעשית בין התאים שבגופה לתאים שמוכרים מהאדם בהיותו חי, זהו סימן בינוני הקרוב למובהק; כשההשוואה נעשית בין הגופה להורי הנעדר או לצאצאיו, אין זה יותר מסימן בינוני. אולם לדעת הרז"נ גולדברג, בדיקה זו היא כסימן מובהק.

סימן בינוני אין בו די כדי להתיר עגונה להינשא. אולם ניתן לצרפו לסימנים בינוניים נוספים, ואז להתיר את האשה.

במסגרת פעילותינו במכון לרפואה משפטית אנו נוהגים, כי כאשר מדובר באדם נשוי יש להחמיר כדעת בית הדין של הגר"ש ואזנר שליט"א, אולם בשעה שמדובר ברווק או באשה יש להקל כדעת הרב גולדברג והחילוק פשוט.
"ואומר לאשר יבוא מכתבי לחזות, אכול את המגילה הזאת. כי מהאוכל יצא מאכל, ושכל יצא משכל ..." (ר' ברכיה בן נטרונאי הנקדן, בהקדמת ספרו 'משלי שועלים').

מחשב
שר האלף
תגובות: 1476
זיך איינגעשריבען אום: דינסטאג יולי 17, 2018 3:57 pm

תגובהדורך מחשב » מאנטאג דעצמבער 30, 2019 11:21 pm

איך האלט אינמיטן ליינען, איך ברויך נאך ווערן קלארער, אבער ביז דערווייל קען זיך עמיצער מנדב זיין צו מאכן א פידי עף פון די לעצטע פאר שיעורים?

ואגב עוה"פ יישר כח גדול Waukesha, כ'בין זיך ממש מחי'.
הוי מחשב...

Waukesha
שר חמישים ומאתים
תגובות: 339
זיך איינגעשריבען אום: מאנטאג דעצמבער 03, 2018 12:31 pm
לאקאציע: Waukesha City, Waukesha County WI

תגובהדורך Waukesha » דינסטאג דעצמבער 31, 2019 5:42 pm

מחשב האט געשריבן:איך האלט אינמיטן ליינען, איך ברויך נאך ווערן קלארער, אבער ביז דערווייל קען זיך עמיצער מנדב זיין צו מאכן א פידי עף פון די לעצטע פאר שיעורים?

ואגב עוה"פ יישר כח גדול Waukesha, כ'בין זיך ממש מחי'.


איך האף, איך זאג נישט צו, צו מאכן פאר ניטל.

אוועטאר
קו הישר
שר חמישים ומאתים
תגובות: 380
זיך איינגעשריבען אום: מיטוואך אוגוסט 27, 2014 5:42 pm

תגובהדורך קו הישר » דינסטאג דעצמבער 31, 2019 7:40 pm

מיר קענען קאום ווארטן.
(וועלכע ניטל? שוין געווען. ניין?)
שיעף גלייך איז אויך גלייך /___\

Waukesha
שר חמישים ומאתים
תגובות: 339
זיך איינגעשריבען אום: מאנטאג דעצמבער 03, 2018 12:31 pm
לאקאציע: Waukesha City, Waukesha County WI

המחדש בטובו

תגובהדורך Waukesha » מוצ"ש ינואר 04, 2020 7:10 pm

אין דעם תגובה האבן אונז מסביר געווען מענדעלס שיטה אין ירושה און דא האבן מיר מסביר געווען וויאזוי פון DNA ווערט פראטיען אבער עס פעלט אונז נאך איין וויכטיגער יסוד, אויב DNA גייט אריבער פון די עלטערען צו די קינדער, און מיר זענען אלע אייניקליך פון אדם וחוה, פארוואס האבן מיר נישט אלע די זעלבע DNA? ווי אזוי קען זיין אז עס איז בכלל דא צוויי אדער מער סארטן פון א מדה? וואס איז געוועהן די DNA פון אדם?

איך וועל פרובירין צו ענטעפרען מיט א משל. שטעל דיר פאר אז ס'איז דא א סופר וואס שרייבט א ספר תורה, ער קוקט אריין אין א געשריבענע ס"ת און ער שרייבט איבער אין די נייע ס"ת, אבער א מענטש איז דאך בלויז א מענטש, און פון צייט צו צייט פאלט אריין א טעות. אויב זאל מען נישט מגיה זיין די נייע ס"ת, און עס וואלט געקומען א אנדערע סופר, און ער וואלט געשריבען א דריטע ס"ת, און ער וועט נאכשרייבן פון דער נייע ספר, וועט ער האבן די טעותים פון די ערשטער סופר, און ער וועט האבן די נייע טעותים וואס ער מאכט, און אויב זאל קומען נאך א סופר און איבערשרייבן פון די דריטע ספר וכו' און נאך א סופר, און נאך א סופר, ביז אפאר דורות וועט די ס"ת זיין אזוי מלא טעותים אז עס וועט בכלל נישט אויסקוקן ענדליך צו די ס"ת פון משה רבינו.

כן הוא בנדון דידן ביי DNA, יעדעס מאל א מענטש וועט געבוירען געשען אזעלעכע "טעותים", און במשך הדורות האבן זיך אנגעזאמעלט אסאך אזעלעכע "טעותים". די "טעותים" זענען וואס הייסט אין ענגליש א mutation, אבער באמת זענען דאס בכלל נישט קיין טעותים, עס איז נאר א לשון המושאל, די אמת איז אז ווען נישט די mutations, וואלטן אלע מענטשען געהאט די זעלבע DNA, און אויב וואלטען אלע געהאט די זעלבע DNA, וואלטען אלע פרצופים געווען שוה, און נישט בלויז די פרצופים נאר אויך דעותיהם וואלטען געווען שוה, און אזא וועלט איז נישט קיין עולם התיקון, נאר וואס דען, די אייבישטער איז מחדש בטובו כל יום מעשה בראשית, און פונקט ווי ביי אדם הראשון איז באשאפען געווארען נייע DNA, ווערט נאך עד היום באשאפען נייע DNA יעדעס מאל וואס א קינד ווערט געבוירען.

נאך א יסוד דארף מען וויסען, אז אפילו עס איז שוין דורך געגאנגען פון אדם הראשון אסאך דורות (אויפן חשבון פון ארבעים שנה אקוט בדור, רעדט מען פון 144.5 דורות, אבער אין יעדער דור דארף מען איבערשרייבען מיליאנען סעלס), דאך איז 99.97% פון מענטשליכע DNA די זעלבע ביי אלע מענטשען. די אלע שיניוים אין די מדות און אין די אויסקוק פון א מענטש קומט פון די אנדערע 0.03%.

דא האבן מיר מסביר געווען די סטרוקטור פון DNA אבער איך וועל מאכן א שטיקל חזרה יעצט, דאס וואס פעלט אויס לההבנה כאן. DNA באשטייט פון א קייט פון nucleotide מאליקיועלס, עס איז דא 4 סארט nucleotide מאליקיועלס A, C,G,T און די DNA מאליקיועלס באשטיין פון א קייט פון מערעררע פון די nucleotides, ע"כ חזרה, מען קען עס אבער אויך אנקוקן ווי א ביך, למשל די Y chromosome אנטהאלט אין זיך 58 מיליאן nucleotides, קען מען עס אנקוקען ווי די Y קראמאסאום איז א בוך געשריבן אין א שפראך, וואס דער שריפט פון די שפראך פארמאגט בלויז 4 בוכשטאבן, (נישט ווי לשה"ק וואס האט 22 + 5 אותיות, און נישט להבדיל ווי ענגליש וואס האט 26 בוכשטאבען) און די בוך ענטהאלט אין זיך 58 מיליאן אותיות (אז מען שטעלט זיך פאר אז DNA איז ווי א ספר, איז די משל מיט די סופר גאנץ ענליך צו DNA).

נישט אלע mutations זענען גלייך, קודם כל לאמיר זיך מתבונן זיין וואס פאר א שינויים קענען אלץ זיין, עס איז דא דריי עיקר סארט שינויים וואס קען זען, די ערשטע שינוי איז, אז עס פאלט ארויס DNA, דהיינו אז עס פעלט אן אות (אדער מער) פון די אלטע DNA וואס איז נישט דא אין די נייע, דער סארט שינוי הייסט אין ענגליש א deletion. די צווייטע סארט שינוי איז, אז עס קומט אריין נייע DNA, דהיינו אז עס קומט צו איין אדער מער אותיות וואס איז נישט געווען ביז היינט, דער סארט שינוי הייסט אין ענגליש א insertion. און די דריטע סארט איז אז אותיות ווערען פארטוישט למשל און די אלטע איז עס געווען אן A און אין די נייע איז עס א T, דער סארט שינוי הייסט אין ענגליש א substitution.

דא האבן מיר אויסגעשמועסט ווי אזוי DNA ווערט פראטיען בקצירת האומר, DNA ווערט איבערגעשריבן צו RNA, און פון יעדער 3 פון די RNA ווערט איין אמינא אסיד, און פון אסאך אמינא אסידס ווערט א פראטיען. לאמיר נאכאמאל לייגען די ליסטע פאר חזרה. (אין RNA ווערט א T א U, אז מען קוקט די ליסטע פאר DNA, דארף מען יעדען U טוישען מיט א T)

codon-table.png
codon-table.png (244.17 KiB) געזעהן 708 מאל


יעצט לאמיר זיך מתבונן זיין אין יעדער פון די 3 סארט שינויים, וויאזוי וועט ער אויסקלאפן אויף די פראטיען? קודם כל לאמיר זאגן אז מען האט אנגעפאנגען מיט א DNA קייט וואס קוקט אויס אזוי CGG-TCT-CCA-TTG-AGT-TCC-TGA די אמינא אסידס פון דער DNA זענען אזוי Arg-Ser-Pro-Leu-Ser-Ser-STOP אבער אויב זאל ארויס פאלן די ערשטע nucleotide פון די DNA, וועט די נייע אויסקוקען אזוי GGT-CTC-CAT-TGA-GTT-CCT-GA און די אמינא אסידס פון דער DNA וועט זיין Gly-Leu-His-STOP וואס גייט ווייטער איז בעצם נישט נוגע, די פראטיען האט שוין באקומען די סטאפ און וועט אויפהערען קוקן די ווייטערדיגע RNA, אבער לשלימות הענין וועל איך שרייבן וואס עס וואלט ווען געווען Gly-Leu-His-STOP-Val-Pro. ווי מען קען זען, דורך ארויסנעמען איין nucleotide, האט זיך די פראטיען אינגאנצען געטוישט, און די סיבה דערפאר איז גאר פשוט, היות RNA טוישט זיך די אמינא אסידס אין גרופעס פון 3, אז מען נעמט ארויס 1 nucleotide, קומט אויס אז אלע גרופעס וואס קומען שפעטער, וועלען זיין צומישט. אזא סארט שינוי, וואס מאכט אז די גרופעס זאלען ווערען צומישט הייסט א Frame-shift mutation.

וואס וועט זיין אבער אז די deletion וועט זיין 3 nucleotides גרויס, דהיינו אז עס וועט ארויספאלן 3 nucleotides? אין אונזער משל, אז עס וועט פעלען די צווייטע גרופע פון 3, און די אלטע איז געווען CGG-TCT-CCA-TTG-AGT-TCC-TGA און די נייע איז CGG-CCA-TTG-AGT-TCC-TGA וועט די אלטע אמינא אסידס זיין Arg-Ser-Pro-Leu-Ser-Ser-STOP און די נייע וועט זיין Arg-Pro-Leu-Ser-Ser-STOP, ווי מען קען זען איז די שינוי אין די פראטיען סה"כ אז עס פעלט אן אמינא אסיד. נאך א משל אז עס וועט פעלן די 2'טע 3'טע און 4'טע, די אלטע DNA און אמינא אסידס בלייבען די זעלבע, די נייע DNA איז CCT-CCA-TTG-AGT-TCC-TGA און די נייע אמינא אסידס זענען Pro-Pro-Leu-Ser-Ser-STOP, די נפק"מ פון די אלטע ביז די נייע איז, חוץ פון דעם וואס עס פעלט איין אמינא האט זיך אויך איין אמינא אסיד געטוישט. נאך איין משל איידער מיר גייען אוועק, וואס וועט זיין אויב עס פעלט די לעצטע 3 פון די DNA, אזוי אז די נייע DNA איז CGG-TCT-CCA-TTG-AGT-TCC און די נייע אמינא אסידס זענען Arg-Ser-Pro-Leu-Ser-Ser, ווי מען זעט איז אוועקגעפאלען די STOP, די תוצאה איז אז די פראטיען וועט נישט וויסן זיך אפצושטעלן, נאר ער וועט גיין צו די נעקסטע שטיקל, און צולייגן אמינא אסידס וואס קומען נישט צו עם.

לסיכום, אויב עס פעלט איין אות, וועט דאס גורם זיין א Frame shift, וואס דאס וועט טוישען אלע אמינא אסידס וואס קומען נאך די mutation, אויב פעלט 3 אותיות, וועט די פראטיען פעלן איין אמינא אסיד, געוואנדען אין צו די דריי זענען געווען איין גרופע צו נישט, קען חוץ פון דעם וואס פעלט אן אמינא אסיד, אויך ווערען געטוישט אן אמינא אסיד. אויב די אמינא אסיד וואס פעלט איז א STOP, וועט דאס גורם זיין אז די פראטיען וועט צולייגן נאך אמינא אסידס פון נאך די STOP, וואס באלאנגען נישט צו די פראטיען.

לגבי Insertion, איז דאס זייער ענדליך צו deletion, מילא וועל איך נישט שרייבן נאכאמאל די משלים, נאר בלויז די סיכום, אויב קומט צו איינס אדער צוויי, וועט דאס גורם זיין א frame shift, וואס דאס וועט גורם זיין אז אלע אמינא אסידס נאך די mutation זאלן זיין אנדערש. אויב קומט צו 3, וועט די פראטיען האבן א נייע אמינא אסיד וואס די אלטע האט נישט געהאט, געוואנדען אין אויב די 3 נייע זענען און איין גרופע צו נישט, וועט זיך אויך איין אמינא אסיד טוישען. אויב די 3 נייע זענען די קאוד פאר STOP, וועט עס גורם זיין אז די פראטיען זאל זיך אפשטעלן און איגנארירן אלע DNA פון נאך די צוגלייגטע.

וואס טוט זיך מיט substitutions? לאמיר זיך מתבונן זיין אין דעם. די אלטע איז געווען CGG-TCT-CCA-TTG-AGT-TCC-TGA די אלטע אמינא אסידס זענען געוועהן Arg-Ser-Pro-Leu-Ser-Ser-STOP, לאמיר מאכן אפאר אנדערע טוישן צו דער DNA, און זעהן וואס די תוצואת זענען. קודם כל, לאמיר זאגן אז די דריטע אות האט זיך געטוישט פון א G צו אן A, די נייע DNA איז CGA-TCT-CCA-TTG-AGT-TCC-TGA און די נייע אמינא אסידס זענען Arg-Ser-Pro-Leu-Ser-Ser-STOP. כאטש די DNA איז אנדערש זענען אבער די אמינא אסידס די זעלבע. פארוואס איז דאס? פשוט, די אמינא אסיד arg האט מער פון איין פאר פון 3 RNA וואס ווייזען אויף דעם, ס"ה האט די mutation געמאכט אז ס'איז זאל גיין פון איין קאוד וואס ווייזט אויף arg צו א צווייטער וואס ווייזט אויף arg. דאס מיינט נישט אז די mutation איז נישט וויכטיג, די סארט mutations ווערען גענוצט ווען מען מאכט DNA טעסטס פאר יחוס.

לאמיר מאכן נאך א דוגמא, לאמיר זאגן אז די ערשטע אות טוישט זיך פון C צו G, די נייע DNA איז GGG-TCT-CCA-TTG-AGT-TCC-TGA די נייע אמינא אסידס זענען Gly-Ser-Pro-Leu-Ser-Ser-STOP. די רעזולטאט איז אז איין אמינא אסיד האט זיך געטוישט. נאך א משל די מילטעסדיגע DNA טוישט זיך פון א T צו א A די נייע DNA איז CGG-TCT-CCA-TAG-AGT-TCC-TGA, די נייע אמינא אסידס זענען Arg-Ser-Pro-STOP-Ser-Ser-STOP ווי מען זעט איז צוגעקומען א STOP אינדערמיט פון די DNA, דאס איז גורם אז די פראטיען זאל אויפהערען ליינען די DNA פריצייטיג. איין לעצטע משל, די לעצטע אות טוישט זיך פון אן A צו א T, די נייע DNA איז CGG-TCT-CCA-TTG-AGT-TCC-TGT און די נייע אמינא אסידס זענען Arg-Ser-Pro-Leu-Ser-Ser-Cys ווי מען זעט האט זיך די STOP געטוישט צו א געהעריגע אמינא אסיד, דאס וועט גורם זיין אז די פראטיען וועט זיך ציען ווייטער און זיך נישט אפשטעלען ווי עס דארף צו.

וואס טוהט זיך אויב די substitution איז 2 אדער מער אותיות גרויס? דאן קען מען עס אנקוקען ווי צוויי באזונדער mutations, וואס זענען איינס גלייך נאכן צווייטען, און מען קען שוקל זיין וואס יעדער טוהט פאר זיך. מען וועט אפט הערען אנשטאט מען זאל דאס אנרופען א substitution, וועט מען עס רופן א SNP אדער Single nucleotide polymorphism אין אידש איין נוקלעטייד, וואס קען זיין אנדערש ביי אנדערע מענטשען.

וואס וועט געשען מיט די פראטיען אויב די אמינא אסידס טוישען זיך? דאס איז שווער דורך צו גיין, ווייל עס זענען דא געוויסע אמינא אסידס וואס זענען ענדליך, און געוויסע וואס זענען
אנדערש, און וואס א frame shift אדער אן אומריכטיגע פלאצירטע STOP קען טוהן איז זייער שווער אויסצורעכענען. אבער איינס פון 3 זאכן קענען געשען, די פארטיען קען ווערען בעסער, די פראטיען קען ווערן ערגער (און אפילו לגמרי אויפהערען ארבייטען, ווי די שטייגער ביי אסאך גענטיק מחלות) אדער קען ער זיך טוישן נישט ארויף און נישט אראפ.

Waukesha
שר חמישים ומאתים
תגובות: 339
זיך איינגעשריבען אום: מאנטאג דעצמבער 03, 2018 12:31 pm
לאקאציע: Waukesha City, Waukesha County WI

תגובהדורך Waukesha » דאנארשטאג ינואר 30, 2020 10:41 pm

ערשטע PDF, פון די ערשטע 4 תגובות, שוין געלייגט געווארען אבער איך האב צוגעלייגט page numbers
DNA1-4.pdf
(112.43 KiB) דאונלאודעד 26 מאל


צווייטע PDF נייע תגובות

DNA5-12.pdf
(194.59 KiB) דאונלאודעד 34 מאל


די PDFs זענען נישט בלויז די תגובות, איך האב אביסל איבערגעשריבן, פארראכטען טעותים, און צוגעלייגט הערות.

אוועטאר
Borough Park
שר חמש מאות
תגובות: 585
זיך איינגעשריבען אום: דאנארשטאג סעפטעמבער 14, 2017 4:05 pm

תגובהדורך Borough Park » פרייטאג ינואר 31, 2020 10:55 am

WOW איך האב יעצט די עורשטע מאל דא אריין געפאלן זייער שיין און קלאר (נ.ב איך האלט און מיטן לערנען די פיעלד סוי עס איז געווען א גיטע קורצע שיינע חזרה)
איך וויל אז די זאלסט מסביר זיין די האסט געשריבן אז א יעדע סעל האט 2 קאפיס פון א יעדע Chromosome איינס פון ביידע עלטערן סוי קודם כל עס איז נאר איין Chromosome וואס איז צוזאם געשטעלט פון 2 Sister chromatids וואס א יעדע איינס איז א Chromosome פאר זיך אליין ווען עס איז צוטיילט אויב אזוי פארוואס האט נישט די קינד 2 Chromosomes וואס דאס איז 4 sister chromatids איך מיין דא צו זאגן זיי מיך אביסל מסביר Meiosis
Life has 2 rules
#1 never quit
#2 always remember rule #1

Waukesha
שר חמישים ומאתים
תגובות: 339
זיך איינגעשריבען אום: מאנטאג דעצמבער 03, 2018 12:31 pm
לאקאציע: Waukesha City, Waukesha County WI

תגובהדורך Waukesha » מוצ"ש פאברואר 01, 2020 8:45 pm

Borough Park האט געשריבן:WOW איך האב יעצט די עורשטע מאל דא אריין געפאלן זייער שיין און קלאר (נ.ב איך האלט און מיטן לערנען די פיעלד סוי עס איז געווען א גיטע קורצע שיינע חזרה)
איך וויל אז די זאלסט מסביר זיין די האסט געשריבן אז א יעדע סעל האט 2 קאפיס פון א יעדע Chromosome איינס פון ביידע עלטערן סוי קודם כל עס איז נאר איין Chromosome וואס איז צוזאם געשטעלט פון 2 Sister chromatids וואס א יעדע איינס איז א Chromosome פאר זיך אליין ווען עס איז צוטיילט אויב אזוי פארוואס האט נישט די קינד 2 Chromosomes וואס דאס איז 4 sister chromatids איך מיין דא צו זאגן זיי מיך אביסל מסביר Meiosis


סעלס וואס האבן געווענליך 2 קארמאזאומס, קענען האבן צעווישען 1 און 4 קאפיס פון די DNA, פאר די סעל צוטיילט זיך וועט ער האבן 4 קאפיס פון DNA, אין mitosis, דהיינו ווען א סעל צוטיילט זיך כדי צו מאכן א קאפי פון זיך, למשל ווען די גוף דארף מער בלוט, וועט זיך א בלוט סעל צוטיילען און ווערען 2 בלוט סעלס, וועט יעדער איינער פון די קראמאזאומס ווערען copied, אבער די 2 קאפיס וועלען זיין צוזאמען אין איין קראמזאומס און ווערען צוזאמגעהאלטען דורך די centomores און הייסען sister chromatoids. יעצט איז דא 4 קאפיס פון די DNA, עס איז דא 2 קראמאזאומס, איינס פון די טאטע, און איינס פון די מאמע, און יעדער פון זיי האט 2 שוועסטער קראמאטוידס, די שוועסטער זענען גענוי קאפיס פון די ארגינעלע, אזוי אז די קרמאזאום וואס מען באקומט פון די מאמע, וועט האבן צוויי שוועסטער קראמטאידס, וואס זענען קאפיס פון די מאמע'ס קראמאזאום. שפעטער ווען די סעל צוטיילט זיך, וועלען די שוועסטערס זיך אויך צוטיילען און יעדער פאר זיך וועט ווערען א קראמאזאום

אין meiosis, דהיינו ווען למשל די pea סעל צוטיילט זיך צו מאכן pollen און די ספיעצליע חלק פון די בלום, וועט די סעל אויך מאכן קאפיס פון די DNA, און די קראמאזאומס וועלן ווייטער האבן 2 שוועסטער קרמאטאידס וואס זענען נאך יעצט גענוי די זעלבע, דערנאך וועלען זיך צוזאמשטעלען אלע גלייכע קראמאזאומס, לאמיר אנכאפען א משל פאר קלארקייט, קראמאזאום 1, איז דא קראמאזאום 1 פון די טאטע, מיר וועלען עס רופן 1ט און פון די מאמע, 1מ, יעצט 1ט האט אין זיך 2 שוועסטער קראמאטאוידס וואס ביידע קומען פון די טאטע, און 1מ האט צוויי וואס קומען פון די מאמע, יעצט וועט 1מ און 1ט זיך צוזאמשטעלען, און אויסטוישן געוויסע חלקים פון זייער DNA, למשל אז 1מ וועט אויסטוישן א האלבע קראמאטויד מיט 1ט, וועט אויסקומען אז 1מ האט איין קראמאטויד וואס קומט פון די מאמע, און נאך א קראמאטויד וואס קומט האלב פון די מאמע, און האלב פון די טאטע. און 1ט וועט זיין פארקערט, דערנאך ווען די סעל צוטיילט זיך וועט איין קראמאזאום גיין צו איין סעל, ,און איינס צום צווייטען. קומט אויס אז די סעל וואס האט באקומען 1מ וועט האבן אין זיך האט 1 קראמאזאום וואס האט 2 קראמאטוידס, 1 פון די מאמע און 1 א געמיש, שפעטער וועט זיך די סעל ווייטער צוטיילען, און די קראמאטוידס וועלן ווערן צוטיילט און יעדער פאר זיך וועט ווערען א קראמאזאום, יעצט איז די סעל וואס האט געהאט 1מ געווארען 2 סעלס, איין סעל האט א קראמאזאום וואס קומט גענצליך פון זיין מאמע, און איין סעל וואס האט א קראמאזאום וואס איז געמישט נאך די 2'טע טיילינג האט די סעל בלויז איין קאפי פון DNA, און פארעם פון קראמאזאומס וואס האבן נישט קיין שוועסטער, ביי peas איז דאס בדרך כלל נאר שייך ביי פאללען אדער די בלום חלק וואס ווערט שפעטער די קערעלע.


צוריק צו “היימישע קרעטשמע”

ווער איז אונליין

באנוצערס וואס דרייען זיך דא: לאטצי, ענוותן און 27 געסט