DNA והמסתעף - נפלאות הבורא

געשמאקע ארטיקלן און בילדער וכדו'

די אחראים: אחראי, געלעגער

שר חמישים ומאתים
תגובות: 268
זיך איינגעשריבען אום: מאנטאג דעצמבער 03, 2018 12:31 pm
לאקאציע: Waukesha City, Waukesha County WI

תגובהדורך Waukesha » דאנארשטאג אוקטובער 03, 2019 5:52 pm

איצל פיצל האט געשריבן:קודם א ריזיגן יישר כח פאר דיין געוואלדיגע ארבייט.
פארשטיי איך שוין ווייטער נישט.
האסט אויבן געענפערט אז א יעדע DNA האט א ריקן ביין פון צוקער און א זייטיגע קייט וואס הענגט ארויס דערפון, און די זייטיגע קייט באשטייט פון איינס פון פיר מינים. אדער איז עס א A אדער א C אדער א T אדער א G. (איך וועל אנריפן די זייטיגע קייט ״טרעפ״.) און עס איז נישט דא אין איין לייטער פארשידענע מיני טרעפ.

לאמיר זיך אביסל בעסער מסביר זיין. יעדער DNA באשטייט פון א מאליקיועל וואס קוקט אויס אזוי TTTTT (גרעסער אביסל אבער כדי צו פארשטיין) יעדער T קען האבן בלויז איין סארט זייטיגע קייט אבער נישט יעדער T פון די TTTTTT וועט זיין די זעלבע, קומט אויס אז די TTTTT קען יא זיין קאלירפול

איצל פיצל האט געשריבן:
אויך שרייבסטו אז יעדע DNA קאנעקט זיך צו זיין חבר דורך די ריקן ביין. און באריכות בוסטו שפעטער מסביר אז עס קאנעקט זיך איין האלבע טרעפ מיט די צווייטע האלבע טרעפ, און די צוויי ריקן ביינער זענען ווי די צוויי זייטן פונעם לייטער.

ביטע זיי עס בעסער מסביר. יישר כח נאכאמאל. מורא׳דיג שיין און באלערנד.

די רוקן ביינער זענען באהאפטען מיט קאוועלנט באנדס. דאס מיינט אז אלע רוקן ביינער זענען איין מאליקיועל. משא"כ די האלבע טרעפ זענען באהאפטען בלויז מיט היידרידזשין באנדס. דאס מיינט אז זיי זענען נאך אלץ צוויי באזונדערע מאליקיועלס נאר זיי בלייבן איינער לעבן צווייטען דורך א כעין מאגנעטישער כח

נאו נעים
שר מאה
תגובות: 132
זיך איינגעשריבען אום: מיטוואך אוגוסט 14, 2019 9:20 am

תגובהדורך נאו נעים » דאנארשטאג אוקטובער 03, 2019 6:33 pm

Waukesha האט געשריבן:
איצל פיצל האט געשריבן:קודם א ריזיגן יישר כח פאר דיין געוואלדיגע ארבייט.
פארשטיי איך שוין ווייטער נישט.
האסט אויבן געענפערט אז א יעדע DNA האט א ריקן ביין פון צוקער און א זייטיגע קייט וואס הענגט ארויס דערפון, און די זייטיגע קייט באשטייט פון איינס פון פיר מינים. אדער איז עס א A אדער א C אדער א T אדער א G. (איך וועל אנריפן די זייטיגע קייט ״טרעפ״.) און עס איז נישט דא אין איין לייטער פארשידענע מיני טרעפ.

לאמיר זיך אביסל בעסער מסביר זיין. יעדער DNA באשטייט פון א מאליקיועל וואס קוקט אויס אזוי TTTTT (גרעסער אביסל אבער כדי צו פארשטיין) יעדער T קען האבן בלויז איין סארט זייטיגע קייט אבער נישט יעדער T פון די TTTTTT וועט זיין די זעלבע, קומט אויס אז די TTTTT קען יא זיין קאלירפול

איצל פיצל האט געשריבן:
אויך שרייבסטו אז יעדע DNA קאנעקט זיך צו זיין חבר דורך די ריקן ביין. און באריכות בוסטו שפעטער מסביר אז עס קאנעקט זיך איין האלבע טרעפ מיט די צווייטע האלבע טרעפ, און די צוויי ריקן ביינער זענען ווי די צוויי זייטן פונעם לייטער.

ביטע זיי עס בעסער מסביר. יישר כח נאכאמאל. מורא׳דיג שיין און באלערנד.

די רוקן ביינער זענען באהאפטען מיט קאוועלנט באנדס. דאס מיינט אז אלע רוקן ביינער זענען איין מאליקיועל. משא"כ די האלבע טרעפ זענען באהאפטען בלויז מיט היידרידזשין באנדס. דאס מיינט אז זיי זענען נאך אלץ צוויי באזונדערע מאליקיועלס נאר זיי בלייבן איינער לעבן צווייטען דורך א כעין מאגנעטישער כח

Waukesha (קען איך נישט פראנאונסן אין יודיש).
הערליך שיין און קלאר!

איצל פיצל
שר חמישים ומאתים
תגובות: 443
זיך איינגעשריבען אום: פרייטאג יולי 11, 2008 1:57 am

תגובהדורך איצל פיצל » דאנארשטאג אוקטובער 03, 2019 7:17 pm

Waukesha האט געשריבן:
איצל פיצל האט געשריבן:קודם א ריזיגן יישר כח פאר דיין געוואלדיגע ארבייט.
פארשטיי איך שוין ווייטער נישט.
האסט אויבן געענפערט אז א יעדע DNA האט א ריקן ביין פון צוקער און א זייטיגע קייט וואס הענגט ארויס דערפון, און די זייטיגע קייט באשטייט פון איינס פון פיר מינים. אדער איז עס א A אדער א C אדער א T אדער א G. (איך וועל אנריפן די זייטיגע קייט ״טרעפ״.) און עס איז נישט דא אין איין לייטער פארשידענע מיני טרעפ.

לאמיר זיך אביסל בעסער מסביר זיין. יעדער DNA באשטייט פון א מאליקיועל וואס קוקט אויס אזוי TTTTT (גרעסער אביסל אבער כדי צו פארשטיין) יעדער T קען האבן בלויז איין סארט זייטיגע קייט אבער נישט יעדער T פון די TTTTTT וועט זיין די זעלבע, קומט אויס אז די TTTTT קען יא זיין קאלירפול

איצל פיצל האט געשריבן:
אויך שרייבסטו אז יעדע DNA קאנעקט זיך צו זיין חבר דורך די ריקן ביין. און באריכות בוסטו שפעטער מסביר אז עס קאנעקט זיך איין האלבע טרעפ מיט די צווייטע האלבע טרעפ, און די צוויי ריקן ביינער זענען ווי די צוויי זייטן פונעם לייטער.

ביטע זיי עס בעסער מסביר. יישר כח נאכאמאל. מורא׳דיג שיין און באלערנד.

די רוקן ביינער זענען באהאפטען מיט קאוועלנט באנדס. דאס מיינט אז אלע רוקן ביינער זענען איין מאליקיועל. משא"כ די האלבע טרעפ זענען באהאפטען בלויז מיט היידרידזשין באנדס. דאס מיינט אז זיי זענען נאך אלץ צוויי באזונדערע מאליקיועלס נאר זיי בלייבן איינער לעבן צווייטען דורך א כעין מאגנעטישער כח

קאפטשאו! איין טעות איז געווען באהאפטן אין מיין אנדערע טעות... סא ווען דו רעדסט אז די ריקן ביינער קאנעקטן זיך מיט א קאוועלנט באנד, מיינט עס אז איין T קאנעקט זיך מיט די נעקסטע T אין עס הייבט זיך אן פארמען איין זייטיגע שטעקן פונעם לייטער מיט פארשידענע מיני טרעפ דערויף.

נאך עפעס, א DNA לייטער קען האבן 4 מיני טרעפ דערויף. דער אמינא עסידס קענען אויך האבן צוואנציג פארשידענע מיני טרעפ אין זיין לייטער?

שר חמישים ומאתים
תגובות: 268
זיך איינגעשריבען אום: מאנטאג דעצמבער 03, 2018 12:31 pm
לאקאציע: Waukesha City, Waukesha County WI

תגובהדורך Waukesha » זונטאג אוקטובער 06, 2019 12:10 am

איצל פיצל האט געשריבן:
Waukesha האט געשריבן:
איצל פיצל האט געשריבן:קודם א ריזיגן יישר כח פאר דיין געוואלדיגע ארבייט.
פארשטיי איך שוין ווייטער נישט.
האסט אויבן געענפערט אז א יעדע DNA האט א ריקן ביין פון צוקער און א זייטיגע קייט וואס הענגט ארויס דערפון, און די זייטיגע קייט באשטייט פון איינס פון פיר מינים. אדער איז עס א A אדער א C אדער א T אדער א G. (איך וועל אנריפן די זייטיגע קייט ״טרעפ״.) און עס איז נישט דא אין איין לייטער פארשידענע מיני טרעפ.

לאמיר זיך אביסל בעסער מסביר זיין. יעדער DNA באשטייט פון א מאליקיועל וואס קוקט אויס אזוי TTTTT (גרעסער אביסל אבער כדי צו פארשטיין) יעדער T קען האבן בלויז איין סארט זייטיגע קייט אבער נישט יעדער T פון די TTTTTT וועט זיין די זעלבע, קומט אויס אז די TTTTT קען יא זיין קאלירפול

איצל פיצל האט געשריבן:
אויך שרייבסטו אז יעדע DNA קאנעקט זיך צו זיין חבר דורך די ריקן ביין. און באריכות בוסטו שפעטער מסביר אז עס קאנעקט זיך איין האלבע טרעפ מיט די צווייטע האלבע טרעפ, און די צוויי ריקן ביינער זענען ווי די צוויי זייטן פונעם לייטער.

ביטע זיי עס בעסער מסביר. יישר כח נאכאמאל. מורא׳דיג שיין און באלערנד.

די רוקן ביינער זענען באהאפטען מיט קאוועלנט באנדס. דאס מיינט אז אלע רוקן ביינער זענען איין מאליקיועל. משא"כ די האלבע טרעפ זענען באהאפטען בלויז מיט היידרידזשין באנדס. דאס מיינט אז זיי זענען נאך אלץ צוויי באזונדערע מאליקיועלס נאר זיי בלייבן איינער לעבן צווייטען דורך א כעין מאגנעטישער כח

קאפטשאו! איין טעות איז געווען באהאפטן אין מיין אנדערע טעות... סא ווען דו רעדסט אז די ריקן ביינער קאנעקטן זיך מיט א קאוועלנט באנד, מיינט עס אז איין T קאנעקט זיך מיט די נעקסטע T אין עס הייבט זיך אן פארמען איין זייטיגע שטעקן פונעם לייטער מיט פארשידענע מיני טרעפ דערויף.

נאך עפעס, א DNA לייטער קען האבן 4 מיני טרעפ דערויף. דער אמינא עסידס קענען אויך האבן צוואנציג פארשידענע מיני טרעפ אין זיין לייטער?

ריכטיג דער אמינא אסידס קענען האבן 20 פארשידענע מינע טרעפ אין זיין לייטער. (די אמינא אסידס צוזאמען אבער שאפען נישט קיין לייטער, נאר יעדער פראטעין וועט זיך שאפן זיין אייגענער shape)

שר חמש מאות
תגובות: 535
זיך איינגעשריבען אום: זונטאג מארטש 18, 2018 4:43 pm
לאקאציע: ליידער און גלות

תגובהדורך שרייזשע » זונטאג אוקטובער 06, 2019 12:12 am

א גרויסען דאנקע Waukesha. עס איז גאר אינטערסאנט.
קיפ אן!

שר חמישים ומאתים
תגובות: 268
זיך איינגעשריבען אום: מאנטאג דעצמבער 03, 2018 12:31 pm
לאקאציע: Waukesha City, Waukesha County WI

תגובהדורך Waukesha » מאנטאג אוקטובער 07, 2019 8:24 pm

  • DNA איז רת Deoxyribonucleaic acid
  • DNA איז צוזאם געשטעלט פון א צוקער רוקנביין און 4 סארט זייטיגע קייטען
  • די צוקער פון DNA רוקנביין איז א פיניווער צוקער
  • אטאמען האבן בדרך כלל די זעלבע צאל פראטאנס ווי עלעקטראנס.
  • א חלק פון אירע עלעקטראנס וועט אן אטאם זיך טיילן מיט א צווייטן אטאם וואס איז זיך אויך גרייט צו טיילן
  • ווען אטאמען טיילן זיך עלעקטראנס הייסט עס א קאוועלענט באנד
  • ווען אטאמען טיילן זיך עלעקטראנס, וועט יעדער אטאם פרובירן צו כאפן ביידע עלעקטראנס
  • אויב איין אטאם איז שטערקער וועט עס באקומען מער פון די עלעקטראנס
  • דער אומבאלאנס איז גורם אז די מאליקיועלס וועלען זיך אויפפירן כעין מאגנעטן
  • גרעסערע מאליקיועלס קענען האבן מערערע פאלער באנדס
  • ווען מאליקיועלס האלטן זיך צוזאמען דורך דער כעין מעגניטשע כח, הייסט עס א היידרידזשין באנד
  • מאליקיועלס וואס האבן מער פון איין פאלער באנד וועלען אויפזוכן מאליקיועלס מיט וועם זיי קענען מאכן די מערסטע היידרידזשין באנדס
  • די 4 זייטיגע קייטן פון DNA האבן צוויי פארן וואס מאכן היידירדזשין באנדס איינעם מיטן צווייטן, A און T, מיט C און G.
  • DNA קומט געווענליך אין פארן פון 2, ווי יעדער איינס פון די פאר האט די פערקערטע זייטיגע קייטן פונעם צווייטן.
  • די צוויי DNA מאליקיועלס שטעלן זיך צוזאם צו מאכן די באוויסטע געדרייטע לייטער אויסשטעל.

שר חמישים ומאתים
תגובות: 268
זיך איינגעשריבען אום: מאנטאג דעצמבער 03, 2018 12:31 pm
לאקאציע: Waukesha City, Waukesha County WI

תגובהדורך Waukesha » דינסטאג אוקטובער 08, 2019 12:37 am

פדף ערשטע 4 תגובות, אביסל פארראכטען, און צוגעלייגט הערות.

(125.81 KiB) דאונלאודעד 40 מאל

שר חמישים ומאתים
תגובות: 268
זיך איינגעשריבען אום: מאנטאג דעצמבער 03, 2018 12:31 pm
לאקאציע: Waukesha City, Waukesha County WI

סדר נחלות

תגובהדורך Waukesha » דאנארשטאג אוקטובער 17, 2019 2:39 am

ווי באקאנט טוהט יעדער מענטש ירשנ'ען געוויסע מדות (מדה מיין איך נישט דוקא מדות ווי רגזן, כעסן וכדומה, נאר אויך אנדערע וועגן ווי אזוי מען זעט א מענטש, ווי למשל אויגען קאליר, האר קאליר וכדומה) פון זיין טאטע, און געוויסע מדות פון זיין מאמע, אבער ווי אזוי פונקטליך ארבייט דאס? איז דא א סדר? אויב יא וואס איז די סדר? אט דאס איז די ציל פון דער תגובה. עס איז וויכטיג צו באטאנען, איז מען רעדט נאך נישט פון וויאזוי DNA שפילט א ראלע, נאר בלויז וואס איז די מציאות פון ירושה.

פאר בערך 150 יא צוריק האט א גוי מיטן נאמען Gregor Mendel, זיך גענומען שטאדירען די זאך, און ער איז ארויס געקומען מיט גאר א קלארע model, עס איז וויכטיג צו באטאנען אז מענדעל'ס סטודיס זענען געווען גאנץ שוואכע סטודיס, עס זענען אפילו דא מענטשען וואס טענה'ן אז גרויסע חלקים פון די סטודיס זענען געווען געפעלטש, אבער אעפ"כ איז זיין מאדעל א גוטע פלאץ אן צו הויבען, ווייל ע"פ רוב איז זיין model יא גערעכט, און מען קען שפעטער צולייגען ווי ער איז געוועהן נישט גערעכט.

לאמיר זען וואס ער האט געזאגט, ער האט שטודירט Peas, דהיינו אז ער האט גענומען 2 אנדערע סארט פיעס און עס מרכיב געוועהן איינעם צום צווייטען, און דערנאך זיי צוגעשטעלט צו זען מיט וואס ענדעלט די נייע פרי מיט די צוויי עלטערען, מיט וואס ער ענדעלט צו דעם, און מיט וואס ער ענדעלט צום אנדערען. ער האט שטודירט 7 מדות, אבער דא וועלען מיר בלויז רעדען פון 1, דהיינו די קאליר פון די פרי. ער האט גענומען א גרינע pea און עס מרכיב געוועהן מיט א געלע pea, און געקוקט אויף די פירות חדשים.

לאמיר זיך אפשטעלען א רגע, און טראכטן וואס וואלטן מיר זיך פארגעשטעלט אז ער האט געטראפען, מען קען טראכטען אז די נייע זענען געוועהן ארגעץ אינצעווישען גרין און געל, אדער קען מען טראכטען אז בערך האלב זענען געוועהן גרין און האלב זענען געוועהן געל, בערך אזוי האט אויך מענדעל געמיינט אז ער וועט טרעפען, אבער צו זיין שטוינענג האט ער געטראפען אז אלע נייע peas זענען געווען געל! וועלענדיג בעסער פארשטיין וואס גייט פאר, האט מענדעל גענומען די דור שני peas, און עס מרכיב געוועהן איינער מיט'ן צווייטען.

לאמיר נאכאמל טראכטען, וואס מיינט מען אז ער האט געפונען? והלא דברים ק"ו אויב די ערשטע דור האט ער מרכיב געוועהן גרין און געל, און דור שני זענען אלע געוועהן געל, דור שני מיט דור שני, וואס ביידע זענען געל, איז דאך זיכער אז די דור שלישי וועט זיין אלע געל. אזוי אויך איז געוועהן מענדעל'ס געדאנקען גאנג. אבער וואונדער איבער וואונדער דור שלישי זענען 75% געוועהן געל, און 25% גרין! דאס האט שאקירט מענדעל. ווי קען זען אז ווען ער האט מרכיב געוועהן גרין מיט געל זענען אלע געוועהן געל, אבער די דור שני מיט דור שני האבן געהאט 25% גרין? נאך מער אויב ביידע peas פון וואס דער דריטע דור איז מורכב פון זענען געל, פון ווי קומט די גרינקייט פון דעם דריטן דור?

כדי צו פארענטפערען די קשיות איז מענדעל אויפגעקומען מיט א טעריע, די טעריע גייט אזוי, עס איז דא זאכען וואס יעדער צומח חי מדבר האט, וואס הייסען genes. יעדער gene איז ממונה אויף אן אנדערען מדה, אין אונזער משל איז דא א gene וואס איז ממונה אויף די קאליר פון די פרי. און פון יעדען gene קען זיין מערערע סארטן (שפעטער האט מען דאס א נאמען געגעבען allele). דהיינו אז עס איז דא 2 סארטן פון די gene וואס איז ממונה אויף קאליר פון די pea. איין סארט מאכט גרין און די אנדערע סארט מאכט געל.

די עיקר חידוש פון זיין תירוץ איז געוועהן, אז די pea פרי האט 2 סעטס פון genes, און ווען מען איז מרכיב 2 peas וועט די נעקסטען דור ירשנען איין סעט פון יעדען פון די 2 peas. און אונזער משל ווען מען איז מרכיב א גרינע און א געלע pea, וועט די נעקסטען דור האבן 1 גרינע gene, און 1 געלע gene. דאס פירט צו זיין צווייטען חידוש, אז ווען א פרי האט 2 genes וואס יעדער איינער פון די צוויי איז אן אנדערען סארט, וועט איין סארט (דער dominant) גובר זיין אויפן צווייטען סארט (די recessive). אין אונזער דוגמא איז געל די dominant וואס איז גובר אויף די גרין וואס איז recessive.

יעצט לאמיר זען אויב די קשיות זענען פארענטפערט, דור שני peas האבן אין זיך איין גרינע gene און איין געלע gene. (דאס איז מוכרח, ווייל ער באקומט איינס פון יעדער עלטערען, און דא האט ער געהאט איין עלטערען מיט בלויז גרינע genes, און איין עלטערען מיט בלויז געלע genes) ממילא ווען מען איז מרכיב צוויי דור שני'ס קען זען 4 מעגליכקייטען 1) ער וועט ירשנען פון די ערשטע די גרינע gene און פון די צווייטע די גרינע - קומט אויס סוף דבר אז די פרי וועט זיין גרין. 2) גרין פון די ערשטע, געל פון די צווייטע - סוף דבר- א געמיש די געל איז dominant די פרי איז געל 3) געל פון די ערשטע, גרין פון די צווייטע - סוף דבר - א געמיש = געלע פרי 4) געל פון די ערשטע, געל פון די צווייטע -סוף דבר- געל. ווי מען קען זען איז בלויז און איינער פון די 4 פעלער וועט זיין א גרינע פרי, שטימט זייער פיין אז 25% פון דור שלישי איז געוועהן גרין.

בנוגע זיין צווייטע קשיא, הגם עס ווערט גאר פשוט פארענטפערט, האט ער געזאגט אז די recessive gene איז א באהלטענע gene, דהיינו אז עס איז דא די גרינע gene, נאר עס איז באהאלטען, ווייל מען זעט נישט די תוצאות פון די gene. היינט צו טאגס איז מער באקאנט די נאמען carrier פאר איינער וואס האט א באהאלטענע gene, ווייל כאטש ער אליינס האט נישט די מדה, קען ער פארט דאס איבערגעבען פאר זיינער קינדער.

די טערמין carrier, ווערט מערסטענס באנוצט מיט מחלות, די סיבה דערפאר איז ווייל רוב פארשעריי וואס מען מאכט אין דעם פעלד פון ירושה, איז פאר מחלות, און ווי מען קען דאס פארמיידען, אבער די אמת איז אז פאר יעדען מדה איז שייך צו זאגן אז ער איז א carrier. פארשטייט זיך, אז כאטש וואס מענדעל האט שטודיריט בלויז peas, האט ער געהאלטען אז די זעלבע איז אמת, ביי א יעדע זאך מצומח ולמעלה, פון הייווען בוז די מענטש.

לאמיר געבן אפאר משלים כדי צו בעסער ארויס האבן די model. איך וועל נישט שרייבן בנוגע א סעפיציפשען מדה נאר איך וועל שרייבן ר פאר recessive און ד פאר dominant. און מען קען אליינס עס אויסטוישען פאר וועלעכן מדה מען וויל, ווייל יעדער מענטש האט צוויי genes, פעלט אויס 2 אותיות פער מענטש, די מענטש וועט נאר האבן די recessive מדה אויב איז ער "רר"

1. טאטע = רר מאמע = רר קינדער = רר
2. טאטע = רד מאמע = רר קינדער = 50% רד, 50% רר
3. טאטע = רד מאמע = רד קינדער = 25% רר, 50% רד, 25% דד (דריטע דור פון מענדעל)
4. טאטע = דד מאמע = רר קינדער = רד (צווייטע דור פון מענדעל)
5. טאטע = דד מאמע = רד קינדער = 50% רד, 50% דד
6. טאטע = דד מאמע = דד קינדער = דד

מיט א שנעלן בליק קען מען זעהן אז אויב איינער פון די 2 עלטערען האבן 2 דאמיניט genes (שורות 4,5,6) וועט די קינד האבן עכפ איין דאמיניט, און וועט האבן די דאמיניט מדה, אז מען טראכט אביסל אריין פארשטייט מען עס אויך גלייך, היות מען באקומט איין סעט פון genes פון יעדער עלטערען, און איין עלטערען האט דאך נאר די דאמיניט gene, ע"כ וועט די קינד אויך האבן די דאמיניט gene.

זייטיגע נאטיץ
צום שלוס לאמיר מאכן א שטיקל דיקטשינערי, סיי פון ווערטער וואס איך האב שוין גענוצט און סיי נייע ווערטער

gene = עפעס (ביז דערווייל נישט געשמועס פון וואס דאס איז געמאכט) וואס איז ממונה אויף א מדה (למשל פרי קאליר), און גייט אריבער מדור דור
allele = א סארט gene וואס טוהט די תפקיד וואס די gene דארף טוהן אין איר אייגענארטיגע וועג (למשל גרין פרי קאליר)
trait = מדה
genotype = ביידע סארטן פון א gene וואס א זאך פארמאגט, למשל די פרי האט 1 גרין allele און 1 געלע אדער די פרי האט 2 גרינע alleles
heterozygous = ווען א צומח ולמעלה פארמאגט 2 אנדערע alleles פאר איין gene למשל גרין און געל
homozygous = ווען א צומח ולמעלה פארמאגט די זעלבע allele אין ביידע סעטס פון genes. למשל 2 גרין alleles, אדער 2 געלע
לעצט פאראכטן דורך Waukesha אום מיטוואך אוקטובער 23, 2019 2:31 pm, מאל פאראכטן געווארן 1 סך הכל.

אנשי שלומינו
תגובות: 4
זיך איינגעשריבען אום: דאנארשטאג דעצמבער 06, 2018 10:04 pm

תגובהדורך ראש_חודש » דאנארשטאג אוקטובער 17, 2019 10:29 pm

Wow ישר כח זייער גיט מסביר געווען !!
אויב מעגלך גיי אויך אין the technical חלקים ווי אזוי דאס ארבעט.

איפה פייביש
שר חמש מאות
תגובות: 778
זיך איינגעשריבען אום: דינסטאג יולי 09, 2013 10:39 pm

תגובהדורך איפה פייביש » פרייטאג אוקטובער 18, 2019 12:56 pm

Wow זייער זייער אינטערסאנט!! ישר כח גדול! זייער קלאר געשריבן נאך קיינמאל נישט אזוי גוט פארשטאנען!

נישט צום גלייבן די נפלאות הבורא!

אפשר וואלט געווען כדי צו בעטן הרב "איינס" צו איבערשרייבן אלעס מיט בילדער אזוי ווי ער גוט מיט די ארץ ישראל אשכול.


שר חמישים ומאתים
תגובות: 268
זיך איינגעשריבען אום: מאנטאג דעצמבער 03, 2018 12:31 pm
לאקאציע: Waukesha City, Waukesha County WI

וואס איז א gene?

תגובהדורך Waukesha » מוצ"ש אוקטובער 26, 2019 10:26 pm

אין די פריערדיגע תגובה, האבן מיר אוועקגעשעלט אז עס איז דא א זאך וואס הייסט א gene, אבער מיר זענען נישט אריין פון וואס די gene באשטייט פון. וואס ווייסען מיר פון דעם

1. יעדער gene איז ממונה פאר זיין תפקיד
2. מענדעל זאגט אונז אז יעדער פארמאגט 2 פון יעדען gene
3. די gene גייט אריבער מדור דור

פאר מיר גייען ענטפערען די שאלה, וואלט כדאי געוועהן אביסל מער מרחיב זיין אין די נושא פון פראטיען. איך האב שוין געשריבען אז רוב פראטיענס זענען ענזיימס, דא האב איך געשריבען איבער ענזיימס.

עס איז באקאנט אז יעדער זאך און די גוף באשטייט פון cells, לדוגמא אן אויג, איז צוזאמגעשטעלט פון אויג cells, די הויט, פון הויט סעלס, אזוי אויך בלוט, האר, נעגעל וכדו', אזוי אויך אלע איברים הפנימיים, אזוי ווי די הארץ, די לונגען, די לעבער וכדו' זענען צוזאמגעשטעלט פון ספיעצילע סעלס. יעדער פון די איברים האט זיך זיין תפקיד, און יעדער פון די סעלס פון וואס די איברים באשטייעט פון, טוהט זיין חלק כדי אז די אבר זאל טוהן וואס עס דארף טוהן.

איינער פון די וויכיטיגסטע אויפגאבעס וואס א סעל האט, איז צו מאכן פראטיענס, וואס די פראטיענס וועלן ענדגילטיג טוהן וואס די אבר דארף אויפצוטוהן, למשל איינער פון די ענזייעמס וואס ווערען פרודיצירט דורך די pancreas הייסט Amylase, די תפקיד פון דעם ענזיים איז צו צוברעכען קארבאהיידרייעטס און starch, און מאכן דערפון צוקער, דאס העלפט די pancreas אויף טוהן זיין חלק אין פארדייען עסן. אלע אברים מאכן אנדערע סארט פראטיענס, לויט וואס עס פעלט זיך אויס פאר זיין אבר, די הארץ מאכט די פראטיען וואס ער דארף, די לונגען וואס ער דארף וכו' וכו'. נאך א וויכטיגע יסוד, קיין שום סעל וועט נישט מאכן קיין פראטיען וואס ער דארף נישט, דהיינו, אז א לונגען סעל וועט נישט מאכן א פראטיען וואס פעלט זיך אויס בלויז פאר די הארץ, וכן להיפך.

מיר האבן אין די פריערדיג'ע תגובה גערעדט איבער געוויסע מדות, ווי למשל קאליר פון האר, די אמת איז אז עס איז פארהאן א סארט סעל וואס הייסט Melanocyte, וואס איהר תפקיד איז צו מאכן melanin (די melanin איז די עיקר גורם פון די קאליר פון האר) , און זי טוהט דאס מאכן מיט די הילף פון אסאך פראטיענס, טוישען אין געוויסע פון די פראטיענס איז די גורם אז די melanin זאל זיין אנדערש, וואס דאס איז גורם אז די קאליר פון די האר זאל אויך זיין אנדערש. כמעט אלעס אין די גוף ווערט געפירט דורך די פראטיענס, און זיי זענען די גורמים פאר כמעט אלע מדות וואס א מענטש האט.

צוליב די פילע זאכן אויף וואס פראטיען איז אחראי אויף, האבן סייענטיסען גלייך געשריגען אז אונז ווייס מיר וואס די gene איז! דאס איז די פראטיען! ווי ווייסען מיר דאס? ווייל מיר ווייסען אז כמעט יעדער תפקיד וואס פעלט אויס צו געשען אין די גוף ווערט געטוהן דורך פראטיענס, איז טייטש אז די פראטיענס זענען ממונה אויף די מדות. ממילא אז סימן 1 פון די gene ווייזט אויף די פראטיענס, בליייבט נאר איבער צו פארשען וויאזוי פראטיענס גייען . מען האט געפראשעט און גפארשעט און מען האט נישט געקענט אויסרעכענען וויאזוי פראטיענס קענען גיין מדור לדור.

כדי צו פארשטייען וואס די פראבלעם מיט זאגן אז פראטיען גייט אריבער מדור לדור פעלט זיך אויס א שטיקעל הקדמה, לאמיר צוריקגיין צו אונזער משל מיט די Pea, און מיר וועלן פרובירען מסביר זיין וויאזוי עס וואקסט פון א pea נייע דורות, די pea מאכט pollen, ווי אויך מאכט די pea א בלום. ווען עס קומט זיך צוזאמען די pollen און געוויסע חלקים פון די בלום, וועט ווערען דערפון א קערעלע, מען פלאנצט איין די קערעלעך און פון דעם וואקסט נייע peas, וואס זיי מאכן אויך בלומען און פאללען וחוזר חלילה נאך און נאך דורות.

פון די קערעלע וואקסט א גאנצע pea. סיי די בלום, סיי די שאכטעל און וואס די פרי קומט אין, סיי די ספיעציעלע חלקים פון די בלום וואס פעלט אויס צו מאכן נייע דורות, און סיי די פאללען, יעדעס איינציגיסטע זאך וואס איך האב דא אויסגערעכענט באשטייט פון סעלס, און ווי פריער אויסגעשמועסט באשטייט יעדער זאך פון אנדערע סארט סעלס, און יעדער סעל מאכט נאר די פראטיענס וואס פעלט זיך אויס, און אין אונזער משל וועט די שאכטעל נישט מאכן די פראטיענס וואס פעלט זיך אויס פאר די בלום

יעצט מיר האבן געזאגט אז די סדר פון וואס איין pea ווערט א דור פון נאך peas איז אזוי 1. עס איז דא פאללען 2. דא פאללען שטעלט זיך צוזאם מיט געוויסע חלקים פון די בלום 3. עס ווערט פון דעם א קערעלע 4. עס וואקסט פון די קערעלע א גאנצע pea, האבן מיר דא 3 סארטען סעלס, פאללען, בלום חלק, קערעלע, יעדער פון די סעלס מאכט נאר די פראטיען וואס ער דארף, דהיינו די פאללען מאכט נישט קיין פראטיען וואס פעלט אויס פאר די קערעלע, און די בלום חלק מאכט אויך נישט קיין פראטיען וואס פעלט אויס פאר די קערעלע, אם כן, פון ווי נעמט די נייע קערעלע סעל, די אונסטריקציעס וויאזוי צו מאכן די פראטיען וואס פעלט אויס בלויז פאר די קערעלע?

אין די אינעוועדיגסטע חלקים פון די סעל, געפינט זיך דארט א זאך וואס פאר יארן לאנג האבן סייענטיסיען געהאלטן אז דאס איז garbage. זיי האבן געהאלטען אז די סעל דארף דאס נישט און עס טוהט גאר נישט אויף, די אייניצגסטע אינטראסאנטע זאך וואס דאס האט, איז אז דאס איז קאלירט, די סייענטיסען האבן מחליט געווען צו רופן די זאכן "קאלירטע זאכן" אדער וויאזוי מען זאגט דאס אין לייטעניש chromosomes...

אין 1928 האט א סייענטיסט געמאכט אן עקספערימענט, און געזאגט אז די עקספירעמענט ווייזט אז די chromosomes, וואס מען שרייט ביז היינט אז זיי זענען garbage, זיי זענען גאר די genes. בליץ שנעל זענען געקומען אלע סייענטיסען און אפגעלאכט פון עם, זיי האבן געשריגען אז ער האט זיכער געמאכט א טעות, אין 1944 האט זיך נאכאמאל איבערגשפילט די זעלבע מעשה, דאס מאל האבן די סייענטיסען וואס האבן געמאכט די עקספירימענט, אויך געווען זיכער אז עפעס א טעות האבן זיי געמאכט, אבער צוביסליך האבן מער און מער סייענטיסטען אנגעפאנגען חושד זיין אז אפשר איז די chromsome יא די gene, און 1952 האט מען געמאכט נאך אן עקספערימענט, כדי אויסצוגעפינען ענדגילטיג אויב genes זענען געמאכט פון chromosomes אדער נישט, די רעזולטאטען זענען געווען קלאר, די chromosomes, נישט די פראטיען, זענען די genes.

אין די קומענדיגע תגובה וועל איך מסביר זיין וויאזוי די chromosomes וואס באשטייט גענצליך פון DNA, שטימט מיט די 3 סימנים וואס מיר האבן געגעבען אויבען אז די gene מוז האבן.

שר חמישים ומאתים
תגובות: 268
זיך איינגעשריבען אום: מאנטאג דעצמבער 03, 2018 12:31 pm
לאקאציע: Waukesha City, Waukesha County WI

DNA צו פראטיען

תגובהדורך Waukesha » מוצ"ש נובעמבער 02, 2019 10:23 pm

ווי מען האלט יעצט, ווייסען מיר אז כמעט אלע תפקידים וואס פעלט זיך אויס פארן גוף, פון פארדייען עסן בוז מאכן די האר קאליר, ווערט געטון דורך פראטיענס. מיר ווייסן אויך אז דאס אריבערגיין פון דור צו דור ווערט געטון דארך DNA chromosomes.

מען קען זיך אפשטעלן און פרעגן א פראגע, ווי אזוי? אויב למשל די עלטערן האבן אין זיך פראטיענס וואס מאכן שווארצע האר, גייט דאך נישט איבער די פראטעין צום קינד, בלויז DNA גייט אריבער, וואס אין די DNA איז גורם אז די פראטיען וואס די גוף פון די קינד מאכט זאל אויך מאכן שווארצע האר?

די תי' איז אז DNA איז א code פאר די גוף, די גוף לייענט די קאוד, און לויט די קאוד ווערט געמאכט נייע פראטיענס. מען קען זיך פארשטעלן ווי דאס איז קאמפיוטער קאוד, די גוף איז ווי א קאמפיוטער, און די פראטיענס איז די תוצאות פון די פראגרעם.

וויאזוי ארבעט די קאוד? עס האט אין זיך 2 שטאפלען, 1. Transcription, אין דער שטאפל ווערט חלקים פון די DNA געלייענט, און ווערט איבערגעשריבן צו RNA. שטאפל 2. Translation. און דער שטאפל ווערט די RNA געלייענט, און ווערט איבערגעטייטשט אויף פראטיען.

וואס איז דאס RNA ? RNA איז גאר ענדלעך צו DNA. אין די תגובה ווי מען איז מסביר DNA, שטייט אז די רת פון DNA איז Deoxyribonucleaic acid, די רת פון RNA איז Ribonucleaic acid, דהיינו אז זיין רוקנביין באשטייט פון ribose וואס פעלט נישט קיין oxygen, און פארדעם הייסט ער Ribonucleaic און נישט ווי די DNA וואס זיין רוקנביין פעלט יא אן Oxygen, און פארדעם באקומט ער די שם לווי deoxy.

נאך א חילוק צווישן RNA און DNA, איז אז DNA קען האבן איינס פון 4 זייטיגע קייטען, ACGT ווי געשמועסט אין די DNA תגובה, RNA קען טאקע האבן די A, C און G זייטיגע קייטען, אבער ער קען נישט האבן די זייטיגע קייט thymine. אנשטאטס קען ער האבן א זייטיגע קייט וואס איז ענדליך צו thymine, וואס הייסט uracil. דאס ווערט קערצער געמאכט צו U. פונקט ווי T, וועט U אויך מאכן hydrogen bonds מיט A.

א דריטער חילוק צווישן DNA און RNA איז, אז DNA איז בדרך כלל double stranded, דהיינו אז עס קומט 2 מאליקיועלס צוזאמען איינס געדרייט ארום דעם צווייטן און קוקט אויס ווי א געדרייטע לייטער, אבער RNA איז בדרך כלל single stranded, דהיינו אז עס קומט בלויז איין מאליקיועל אויף א מאל.

ווען DNA ווערט איבערגעשריבן צו RNA ארבייט עס אזוי, עס וועט קומען אן ענזיים וואס הייסט RNA polymerase, און וועט זיך ארויף זעצן אויף די DNA, דארט ווי די צוויי זייטיגע קייטן קומען זיך צוזאם, דהיינו אויף דער טרעפ פון די לייטער, אויף די מיטעלע חלק פון די טרעפ, און ער וועט זיך נעמען ליינען איינער פון די זייטן, למשל אויב וועט ער ליינען די רעכטע זייט פון די לייטער, וועט ער קוקן וועלכע זייטיגע קייט ליגט אויף די רעכטער זייט פון די טרעפ אויף וואס ער טרעפט זיך יעצט, לאמיר זאגן אז עס איז א G, און ער וועט אויפזוכן אן RNA וואס זיין זייטיגע קייט מאכט hydrogen bonds מיט דער DNA זייטיגע קייט, אין אונזער פאל איז דאס די C, דערנאך וועט ער גיין צו די נעקסטע טרעפ, און וועט עס ליינען, לאמיר זאגן אז דאס איז אן A און ער וועט זיך אויפזוכן א RNA שותף פאר די A, וואס פאר RNA איז דאס U און ער וועט עס באהעפטן (דורך די רוקנביינער ) צו די C פון פריער, און ער וועט גיין צום נעקסטער און דער נעקסטער און אזוי ווייטער.

rna-polymerase-1.png (41.02 KiB) געזעהן 298 מאל

לאמיר דא געבען א משל

CGGTAAGGTATCACTCAAGA - זייט פון DNA וואס ווערט געליינט
GCCATTCCATAGTGAGTTCT - זייט פון DNA וואס ווערט נישט געליינט

זייטיגע נאטיץ
אויב קוקט מען זעט מען אז די RNA איז כמעט די זעלבע ווי די זייט פון DNA וואס ווערט נישט געליינט, און אז מען טראכט אביסל פארשטייט מען אויך פארוואס, די סיבה איז גאר פשוט, סיי די RNA, און סיי די אנדערע זייט פון די DNA, באשטייען פון די שותפים פון די DNA וואס ווערט געליינט, צוליב דעם אויב איינער קומט און זאגט דא האסטו ביידע זייטען פון א chromosome, זאג מיר וואס די RNA וועט זיין אויב מען ליינט די רעכטע זייט, איז גרינגער צו קוקן אויף די לינקע זייט און בלויז טוישען די T's צו U, און נישט טראכטן וואס איז די שותף פון A? און דערנאך G?

יעצט האבן מיר שוין אן RNA און מען איז גרייט צו גיין צום נעקסטען שטאפל, Translation, און דער שטאפל וועלען קומען ribosomes, וואס וועלען נעמען די RNA און עס פארטייטשען צו פראטיען. דא ווערט אבער א פראבלעם, אנדערש ווי DNA און RNA, וואס ביידע האבן בלויז 4 זייטיגע קייטן, וואס דאס איז זייער גרינג צו טוישען איינער צום צווייטען ווייל יעדער איינס פון DNA האט א שותף אין RNA (דהיינו A ווערט U, די C ווערט G, די G ווערט C, און די T ווערט A) אבער די פראטיען ווי עס איז דא 20 אמינא אסידס, ווי אזוי קען מען פון 4 RNA וויסן וועלעכע אמינא אסיד צו לייגען? די תי' איז אז טאקע אנדערש ווי DNA צו RNA ווי יעדער DNA ווערט 1 RNA, ביי די פראטיען ווערט פון יעדער 3 RNA איין אמינא אסיד.

פארוואס 3? ווי געשמועסט דארף מען האבן קאודס פאר 20 אמינא אסידס, אויך דארף מען א קאוד פאר ווען די פראטיען איז פארטיג, דהיינו א קאוד וואס הייסט די ribosome אויף הערען צו לייגען מען אמינא אסידס, בסה"כ דארף מען 21 קאודס, אויב וועט מען מאכן קאודס פון בלויז איין RNA, וועט מען נאר האבן קאודס פאר 4 אמינא אסידס, אויב 2, וועט מען האבן גענוג קאודס פאר 16 אמינא אסידס (4 מאל 4), אבער מיט 3 קען מען האבן 64 קאודס, און דאס איז איבער גענוג פאר די 20 אמינא אסידס מיט די סטאפ, יעצט אבער קומט אויס אז מען האט 43 איבריגע קאודס, וואס געשען מיט די 43 קאודס? די תי' איז, אז עס זענען דא געוויסע אמינא אסידס וואס האבן מער פון איין קאוד, למשל די סטאפ קאוד, איז דא 3 קאודס UAG, UAA און UGA, געוויסע אמינא אסידס האבן 6 קאודס, און געוויסע האבן בלויז איינס. דא האב איך צוגעלייגט 2 וועגן צו זען וועלעכע קאוד גייט צו וועלעכע אמינא אסיד.

codon-table.png (244.17 KiB) געזעהן 298 מאל

codon-chart.jpg (54.27 KiB) געזעהן 298 מאל

לאמיר איבערגיין אין איין שורה וואס גייט דא פאר, DNA ווערט איבערגעשריבען צו RNA, דערנאך וועט פון יעדער 3 RNA ווערען איין אמינא אסיד לויט די codons פון די אמינא אסידס און אזוי ווערט א פראטיען.

זייטיגע נאטיץ
צוויי זאכן האב איך געוואלט אויסשמועסן בדרך אגב

1. ווען איך זאג אז די DNA קאוד איז כעין א קאמפיוטער מיין איך עס גאר ערענסט, בשעת די צווייטע וועלט מלחמה האט א ענגלישע גוי מיט'ן נאמען Alan Turing געבויט די ערשטע קאמיפוטערס כדי צו ברעכען די דייטשע enigma קאודס, חוץ בויען די קאמפיוטער האט ער אויך געמאכט א ליסטע, וואס כדי אז א כלי זאל זיך קענען רופן אלץ א קאמפיוטער, מוז ער קענען טון די אלע זאכן אויף די ליסטע. כאטש וואס ער האט דאס געשריבן בשעת די מלחמה, און מען האט ערשט אויסגעפונען אז DNA איז די gene ערשט 7 יאר נאך די מלחמה, דאך ווי איך וועל אי"ה מסביר זיין אין די קומענדיגע תגובה, האט DNA אלעס וואס שטייט אויף די ליסטע.

2. די ribosome קומט זיך באמת א תגובה פאר זיך, דאס איז נישט בלויז איין פראטיען נאר דאס איז א machine, דאס איז צוזאמגעשעלט פון אפאר פראטיענס וואס ארבייטען צוזאמען. די סעל האט מאשינען וואס וואלטן זיך געקענט פארמעסטען מיט די גרעסטע פארבריקען, די ribosome, וואס באמת איז בלויז אן הכנה צו מאכן א פראטיען, איז בלויז איין דוגמא. ועוד חזון למועד.

שר האלף
תגובות: 1175
זיך איינגעשריבען אום: דינסטאג יולי 17, 2018 3:57 pm

תגובהדורך מחשב » זונטאג נובעמבער 03, 2019 2:36 pm

WOWֱֱ! יישר כח! עמיר אפירזוכן אפאר איבעריגע מינוטן, און ליינען מיט ישוב הדעת.
הוי מחשב...

צוריק צו “היימישע קרעטשמע”

ווער איז אונליין

באנוצערס וואס דרייען זיך דא: מי כעמך און 31 געסט